Description :
From Genome Similarity Track
Location :
contig_38:147650- 159620
Transcript NameFunction/comments
g8328.t1hypothetical protein
g8329.t1hypothetical protein

Sequence
11970 bases(100 bases per row)
ATAGGCAGTGCTGTTACTGTTCCGGTTTGGGCATATAATCCTGCCGAGCTGCATCCATCAAATGACCCTTGAGTGTTAACTTCGGTGCGGTTCCACTTTT
GTGATGTAACGGAGAAGCACCACATATCACACAAATAGGTTCCTGTCCGATTAACACCTCCAAAAATCCAAAGGTTGCCAAGATCGGAGCACATGCTATA
GCTCACTCTTCCCTCTGGCAGCATCACTTGAAGATCGGGCCTTATATTCCCACTCGACAAACTACCTGATACATCTCTCGAAGCGCCAATATTATCGTCG
TGACACAAATGCCAAAGCCGGTCAAATGTATTGTACCGCCAGAGATCCGACCGAAATTTCTCTTCGCGATCTTGCCCGCCGAAAACGTACACACATTCTC
CAATAACAGCGGACGAACATCCGATTCGTGGGCCAGGATCCAGAGAAACCGAGCTAGGTAGTCGCGACCATGCATAATCATCGAGGGATAAGTACCAGGC
GTCTCCAAGGACCTCGTTGTCTACTGATTTACCACCATACATGAAAACGATCGCGTCGAGACGAACGCGAATTGTCGAAGCCGTATGGAACGCACGAGAT
TGGGGCATTGAAGTTGCCGCCCCAAGAGCAGCTTGAATTAAAGTCCATGTCGGAAGAGCCATCAGCGTTCTTCGTTGTAGGGCATTTGTACAGATCCATA
TGCCGTGATGTTGCACAATTATTCTCGCCCCCAAGCACAAGGATCTGATTGTCATCAATTGCAACAACCTGGTGATTGCGAATTCCAATGGGTAAGTCTG
TCCACCTCTCCCAGGTGCTAGTTTCCGTATTGTACGCCCAGACGTGATTACTTGGTTCAGTAGGCTGGGGCATTGGGGCATCCGCAATAATCATTCCGCC
GACGACAAACAACGTGCTATCCGCTAAAACTGATGCAGATCCTTCAAGTGCCGGTGGATGTATTGCTGTACCTCTTGCTGGCTCATTTGGAGGTGGCTGA
ATTGTTGCGGTGGAAGAGGGCGTAGTTACCGCGCGTGAAATACTGTCAAATTCATGACCAATCGACGGGGGGTATGCGAAAGGTTGGTGTCCTAAATTGA
TGCGGATGATTTCACCCGTTCAAGACTGATGCCAGGCATCATACCCGATCGCTTGTCGTCTACAGAGCACTTGAATTCAGAGTATGCGACACCCAGGTTG
ACTCCATTTCGATAAAATGTCATCTCCTGCGTGTTTAAGTCCAGCAGGCAACCGATGATATCACCAGCTCTCCATTTCTCTCCGTATGAAGATGATCCAC
TATTCCAGCGTCGCTGGCGGTTACCGTCGTACGACCATGAGTGAGCGTGATCTCCGACCCTTCACCTTGGTCTGAGCTTCCCTGAAAGTACCCATCGATC
CACCCAACTTGAATCAAGCCACTTGTGACCACCTCTACCTCATAAAACCACTTCCCTCGAAATAACGACACACCGATTGTTGATATTGAACCGAAGTTAC
TCAAGCCTTCGATCTCGCCAGAACGATCAATATCAACACGACCGCAGACTGACGTCACACAGCTTTGATCCAGCATAACGGTATCACCTTCATCATTATC
GCGTTTTCGCTCCACAATCAAGGACGTGGTATAAAAACCAGCTGCAACATCCAAGCACCGACGGGAATTTTTCTCTGGTCGAACTTTCAGAGGAACAGGC
AATAATGCGTCTGCGCTGCCTCGATTTCCAAGTTGTCCCTTGTTATTCCGTCCGAACACGTAGACTTGGCCGTGTTCTGAAAGTAGCACTGTGTGATAGC
ACCCACAAGTCGCCCGCATCATTCGCGTATTGGCGGATAAAGCTACAACATTTGGAAGATTCTGGTGAATCTTGTTTCCGATACCTAGTTGCCCGTAATC
GTTCCGACCAAATGAATAGGTTCGTCCACCCGTGGTGACAACAACCGAATGGTAGTAGCCGCATGCAACAAAGCATACCATTTCGTTCGGAAGTGTGACG
ATAGTGGGTATCTTAACTTGACGATTGTGAGCTAGGCCCAACTGCCCATAGTCATTCTTTCCGCAGGAAAAAAGTTCTCCGGTGGCTGTGCAAATGACGG
TATGGTACAGACCGCACCCTACCATTGACACTTCAGTACCTTCGAAACTCTTCACAAGCTGCGGTGTGGATTGGTGCTGTGTGTGATCGAGACCAAGTTG
GCCACAATCATTCATGCCAAAAGTGTAGAGTTCCCCGGAATCCGTGATCACGGCGCTGTGGTGGTAACTCACAGAGGCAAACCCAAGCTTCTTTGTCCTA
AATGATTCAATAAGTTTTGGTACATGAATCTTGGTGGCCAAGTTTTCATGCCCCAACTGTCCCCGGTCATTGTAGCCCCAGGAGTACGCTAGCCCAGTGT
CCGTTAGCGCGATCATATGCTCGCAACCGTTACTCGCTGCAATAGATTTTATTCGCTGTGAGCGCAGAGCTTGCACGGGGCGAAGCATCATTACCCTCTC
GTCGAAGTGGCCCTGGCCACACTGACCGCTTTTGTTCAATCCGCAGGTTAGTACGACTCCATCATTTGTGAGAATCGCCAATGTTTCGTTGCCACTGACC
ACCTGACGAATATCGTCCCACCCACAAAGAGCTACACTAGTGAGTTGATGCCGCTCAATATCATCTCCTGTGCCTAGTTCTCCGTACGAGTTCTGACCAC
AGCTGTACAGCTCACCTGAGGCCTCACACTTTCCATACATAGGCTGTTCTTTGAGCGCGGCAAGTTTGGCAATTGATGTCTCCAAATTCACTGCTCTCGT
TGGTGGCTGCTTCATTAGCCAAAGTATCACAAATAACATTGTCGCAAGCGATCCGCGGGCAAGGCCCACCTCTGCTAGCGTTTCGATCGTGCAAGCTCCG
ATATGAACTTCACTTTCAGATGCTCCATCATCCACCGGGTATGCCAGATCACCTAAGCAGTCACTTAGCAAATTGAATGCTGACGATGCGGACGGTGCGA
GGTACATACTGTCCGAGTAGGCAGTAGGCTTCAAAGGTTTCAGGGTGGCCTTCACCATTTGCAGTGCGTGTTCGTACTGTTCTGGGTTGTTTTTGCGTGT
TGCCTTCAGTAGCATGACCACCAGGTCCCAGCCCATTGTCATGCAGTTTTGGGTCGGTAGTGGCAGCGGGGGGGGCGACACTTTACGCAGTGACATGGCG
TGAGCTCTTGCAGCCAGGAGTCGTTGTTCGTACCGGTATTTTTCCTTCTTCGTCATCTGGTACAATGCCTGCAAGTTTCTCACGTAACTCGCCACCCGGG
CGTCGAAAACGCCAGGCATCGCCTCACCCGCATCTCGCTTACTGTCTTGTCGTGCAGACTCTAGTCCGTCCTGGGACGGCAGCCCTGCCAGCTGTGAAAT
GTGCTGGAACAACTCGTCCACCGAGTCCACGGAGCTCATGAGCTCCTTCATCTGCTGCTCGGGACTGCGTGTCTGCAGTCGTCCGGACACTTCACTCTCT
GTAGGGGCACAGAGGTAACATACACGAGGTCATTCCCTCGTTGAAGATTGAAATACTACCTACTAGAATTGCGTGTTACCTTTCGGTAGGTGCCGCAGTG
CGGCGCCAAACTCGAGGATCTTGTCCATTACATCTTTTGAGTCTTCGGTAGCGGACGGGACAGACACGTCGCCGGCTTTGAGCACGTCGCAGAGCGGGAC
GTATGGCGCCTGGAGCGGCCGGAGCAGAGTGCGCTCGCCCGGCGGCTGCGTCACCGCGGCCGGAAGCGAGACCTGCTGCCCCATGACCCGTCGCCAACTC
GCAGCTTGCTGTTGGTTGTCTGCTGTGTCTCTTGTGCCTCTGCGCGCCAGCTCAACTCGATCAGTGGCGAAGATCATCGGCCCGGCAGCCGCGACTCTTC
CGGCAAAATGTATCTTGTGTTCGATACATAAAAAACATGTTGATTGGTTGAAAATAATAGTGCTGTTATGGGCGATAAGTGTTTTGTTTCCTTAAAAAAC
AAAACACTCGTTATATAGCCCGATTGGGTAACACGAGACTGTCCATTCATGCCCAACGAGGCCCGATCCTGGTGCCCGAATGTGCCCGACTAGGAAAGAG
TCGGAGAAGCATCGCGCGATGAGTCCTTCACTGTATACGTATAGCCGGACATTGGCTTGGAGCGTCGACTTGCATTTTTCAACCAAGAATCGCCACTCCG
ATATAATATATACAAGTTGAAGGCATCGTGCAGCATGTCAACCTGGTCCCATGGGGAAGAGATTAGCATAGATAGAAACAGGTTCTCTTGAAAACGAGGA
GCGGTACCTTTCCCACGAGTTCTTGTACTGTTTCATCGCGTTGCGTCACTTCTCGGGCTTGAATCTACATCCAGACGCCACCGCTTAGCTGCTTGAATAC
CATTTCACGGAGAATTGACTCCTCACCTCAAGGTTGTTCTTGAGCTCTTCAACATCTGAAACAAGAGAATTCTGCAAGAAACACAGCAACAGGAACTCAA
TCAGTTCAAAACAACAAACAGCAGTATGTAAGCCGTCGTACGGTCTTTTTTGTCAATGACACTGCTGATAAGGACTTGGCGGTAGTCGCCACCCCCGCCT
TGGAGCTTTCTGTAGGCCGGCGCAGCGCCACCATCGATGGATCAGGTCCCTCGCCTGAGCTTCACACTCAGTCGGCGCACGCTATCCGTTATGTCCGTTT
TCCGGGCCATGCTGTCGAGTGCAGCCTGCGACGTGGCTATTGGTGGGCAGACGACTCGCTTTGCCGGTCTTCTCCGCCGCTTGCTGAATCGCTGCTGGAA
TGAGTGCAAATGCGCCGCGGTCGTGCTTTGAACCATGGAAAGCACGTGACTAGCGATGCATTCGAGCGGATCCGCACGGCAGAGTTTGTGGCTTGTGTAG
CTTCCTATCCGCATCAAAGTGGAGTCCACGATGGACCGCGTCGAAGTGCAAGACATGGGCTCGGAGACGCGGCAGTGCCGCACCCAGCTTCTTCTCCACT
AGCTGCGCGGTTTCACCAACGGGACAGCTGCTGCAGCCTGCCGTTGGGCCGTCGTGTTAGCTATCAAGAGACTGTGCCAGAAAGAGACTCTGTCAGCGGG
CGCACTTACGATCAGAAGAACCCAAATCCGTCCTTCATCCCAGAGCAGCTCGAACTCACGTTTGATCGAATCAAGGTGCGCCTGAGCCGTGCGCCTCTCA
AAGATCTCTCCGTGGCGGGCTCCATCGAACGCGACCGCGCTGTAGTTGCCCGTGCCTTGTAAACCAAACTGCCAGCTCGGAGTACCCGCTGCGGCACTGC
TGTCACCATCGCTTGACGCTACAGATGAAAAGTACCGCGGGTATCTATCTCAACTTGCCAGTTGTTTTGCACGGCAAGAGACCACATGTGTTCGTCAAAC
TCAACGGCGTGTGCTCCAACAATAGGACCACGCAATACAACAGTATGTTCCCAATTCAACGTCATTCCCCCCACACTCCAATTGCAGCTTCCCATCGTCA
ACACGGTTCCATCGATAATCGCTACCTTCCAGTGCATGAGTCTGGGGCCTGCGTGATATACGTTGACCCCGTTTTCGATCATCATAGGTGAGCTTTTCTC
GGTGACTTGTGCCCGATCAACGAGAACACGAACCGTGACACGCTGGGAGGCACGGATGATAGCGTCGGTCAGTTCAGGATGCGACAAGATGAACATAGCG
ATATCTACTGAGGTCTCTGCGCCGTCGAGCAAATCAATGAGCTTCTGAGGTGCAGCTTGGTCGCGAGAAAACCAGTAGTCTACAACTGCAGTTTGTAGTC
TACCCAATATGTCCTGCTCCATGCGGCCAAATACTCGACGGTCGACCCCCATTATTTGCGATGTCCTTGAGCGATGGGTTTTCCGTGACGCTAAGACCTC
GTTTCAGCATTTCCACCACGAAACGCATGGGGGTCCACCGATAGGGTTTACCTGACTTGGACTCGTCTTTGGGCTGGGCGTGGACGATGGCGTCGATCGT
ACCGCGGGCGTGTCCCGTGCTTTGATGCAGCTGGGTAATTCTCTCCCCTTTCTGGTATCGCATGCGAATCTGGGACTTCTCTGCTGGAGTTAGTCGCGGA
CGGCGTTTCTTGGGCAGCGGACTTTGCGTTCTGTAGGCATTCGGCACGACGCGTCGCGAAGCAGTGTACATTTGACGTGCTAGGAAAAACGGAAGTGGCC
CGACCTCCGATCCTCCACGTTGACTGAAATAATAATGGCTCGGAAAGTCCGATCCTCGACGCTGCTGTTTAACTGGCTCGGAACGTCGCAAAGTGGGCAA
CTTATCCTCGAGTCGAGGATAAGTTGCCCACTTTGAAATTTCCGAGCCAATTAATACAGCAAAAAAAAATGTTGGGCAGTGGGCAACTTATCCTCCACTG
GAGTGTGAATTGCCCACTTTCCGACTTTCCGAGCCATTTAACCCTTTCGCGACGCCCTTGGATAAAGTATACTATACAAGGTCAAGATACTCCGATCTAA
AAGGGCACAAAATTCGCCCTTTAAGGTTTTCACGGTACTCGCGTGAGGCTTGAGTGCTGTTCACTATCCTCCCGGATGCGGGATAGAGAAAGCCGGACGG
TCTAAAAGGGTACAAAATTCGCCCTTTAAGGTTTTCACGGTAGTTTCCAAAGACGCAGCGGATTGGCTCATATTTTTTTTTCTTGCGGCGACTAGACGAA
TTCGACGATCATTGGTTGAAATGCAACGAAATTTACGCAGTAAGAAATCGCAGCCTTCGTAAAATACCATACCAGTCTCGTCTCCGCGCGATGACGCGGT
TGAAGCTGTGTACACGTCACTACGATGGCGACGCAAGCTAGTTGCCCTGGGTTAGCGAGGCAGGCAGCCTGCCGCAGGCTAGCCGTGGTCTGTGCGGGAC
ACGTCGTATGGACGTCTAGTGCAGTGGGGAAAGGTAGTTTAGCAGAGGAATAGATAGACCAGAGAGTTGTGTTTACAAGGCTGGTTAGCAGAGATGAGCG
CTGAACTGCTGTGCGCTTGGCTATTATGAATTGTGAGTTTTACTGATTTGGTCTTCCATATATGCATCTGATTGGGAAATCCTATGCCTGTCTGTTCCCG
CTCTATCCATAAGCACCAATGGGAGTAAATATCTCTGTCTCACTATGCCGTTGACCGATTTACTCATCCAAAGAGACCCTGGGGTGAATTTTAGTTTTTG
GCGCGAACCTATAAAATGATCACCTTCCCAAACCGATTGGTATCAATTAGAGTAATGAATAAATGATGCATGGCATCATAACTCTATTAATTTATGCCTT
GAGACATAAAACCCATGCCGCTCGCAGGCCACACAACCGATTTTTCTCCCTCGCGGGGATGCCGAAGCGCGACCGCGATGAAGCGCGAAAAATGATAGAG
AAGCGTCCACGTCGACGGGTGCGCCACCTAGCGAGCGCAGCAAGCGATCTGGGCGGTGTCGTCGCATTCAATGACGTGTGGACATGGCTCAAGAAGTCTG
GCTGGTATTCTAAACCGCCTCCCAGACGTAGTCTGGACCTGCGCTATCGCTACGTTCGACCGGATGGTGATGCAGACGGTCAAGAAGGCGTCGATTACCT
TCTTGGCGAGGCTGCTGTTCTTCGGTATGCTGCCGCCCTCACAAGTACGAGTCTTGCTTGTGTGAACGTTCGCGGCGGTGGTGCTAACGACGCATGAGGG
GTTGTTATGTCATCAGGGGGCAGAAACGACAACGGCAGCAACGAGCATGCCGAATCCAGGTCAAGAGTGGACGAAGATCGAGGAGGGCGCGAGCGCGGGC
GAGGCAGTGATGGCCGCGATGGCGGACATGGCGTGGCACCGGGTGCGTATCCGATTGATTCAAGAGTAGTGACTGCAGCTGATGGTATTTGTGCGTGGTG
GTGCGTAGCAGCAACAGGCAGTAACAAAGACGGCAGCGGTAATCTGGCGGCATCCAGGCCAAGTGTGGATGGAGCTCAAAACAAACGCGGACACGGTCGT
GGCAGTGGTGGTGGCAGCGACGGCGGACGTGGCAGTGGTGGCGGCGACGGCGGACATGGCAGTAGTGGCGGCGACGGCGGACGTGGTATTGTTGGCGGCG
ATGGTGGACGTGGCATTGCAGGCAGCGACGGCGGCCGTGGCAGTGGTGCTCGCGCTCGTGGACGTGGAGGCGGCGACGGTGGACATGGTATTGTTGGCGG
CGACGGCGGACGTGGCATTGCAGGCAGCGGCGGCGGCCGTGGCAGTGGTGCTCGCGCTCATGGACGTGGTGTTGTTGCTCGCGATGATGGATATGGTATC
AGTTGCGGCGGTGAATGTGGCATTGGTGGTGGTAATCGTGGCAGTGGTGGCCGCGTCGGCGGACGTGGCAGTGATGAAGGACGTGGCGATGGAATGGGTG
CGTAGTTGTCTTGTTGCCGTCTGCTGTTTAAGCATTCATCATGTATGTATTAATATGAATATTTGTATACTTGTTGTAGTATCAAGCGCTGTTCCTGGGA
CGCCACAAGCCACAACTCGGGGGCAAACGCCCGACTCGTTACATCGGACCCAGCCAGCGAGGACACCTCCGATAATGCTGCAGGAGGTATACATGAATAA
GTTGGTGGCATTCACTCCGGAGCGCGAGACCTGGATGAAGTCCAAGCTCTACCGCCCTATCGGACCGGCATACATTGTGGGGCGTGTTTGCCGACGTCCG
ATGCGAGGAAAGTTTGCGTCACTGTTTGAGATCCGCTGGCTGGATACTCAGTTCCAGAACGCTGTGGAACATGTGAGTGTCGGATGTGTTCAATCTGGAG
TGGAGAACTACAAGGAGCTTACCCGGTTGAAGGACAACCCCGACTGGCAAGGGCTAGTAACGGGTGACGCCGACGATGACATTGACGTGGATGATGACGA
CAATTTGCAAGTGGTGGAAGAATACAGAGAATTTGATCCGGGTGTTTTGCTTCCTGCCAATATGGAAGAAGTCGAAGCGATTCGAAATCTGCGATTTGAG
CCCAACGGAGAAGTTGACGCGCCGACTGACCTCTACCAGCTTGCCGACGGCTCAACGAAAACGACCCTTCTACCACAGTATAAACACCTGTTTGAACACT
CGGCCACCTCCAGCTTTTTTGCGTACCTGCCTCTGTACTTCTGGCGCCAAGTGCTGTTTGAGACGAACAAGTATGCTATTGTGCACGACATCAAAATTGG
AGCACCATTCACACTCGCGGAGCTGATGGCGTTTCTAGGCATCATGTTTTATATGGCCTTGAACGACAAAGGTGAATATGCGAACTACTGGGGCCAACAA
CCAGAAGACCTGATATTTGGTGGGAACTCCGTCTCGCTGGATAGCGTGATGTCTCTAAGTCGCTTCAAACTTCTGCGGTGCTGCCTGAGTTTCAATGCTG
TACCGACCACACTGGATCGTGACGCTGCTGCTCGTATCCGACCTCTACTAAACTTGCTGAAAGTGACTGGTGGTCTCTATGTCAAGGTTGGACGTAATGT
GGCTTTGGACGAAGCCAGTATAGCGTGTCGGGCTCGACAAGGAAGGCACATGATCGTGTTCAATCCCATGAAGCCAACGGGTAAATACCATTTTCGGTTC
TATGTTGCCTGCTGCTCATCTACCTGGATCGCTCTAAACTACAAGCTACATTGCAGTAGGTGTGATGTTGGCGACCGGCTCGATGGCGTAGTTGGACAGG
AAGAAGCACTGTCGCTGCGAGTAGAATTTGACAAGGTGTCTAAGATTCGACAGCACGTGTTGGAGGTCGTGAGGCCATTTTTCGGTACTAACCGCATCAT
CAACATGGACAATTACTACACTTCGGTCCAACTGCTTCAAGAGCTGAAGCTCAAAGGTCTTTACGGTCGAGGAACCATCAAATCTAACAGCAAGCACTTC
CCTCGTCACACGATCCTGGATGATTCTAAATGTACGCGCGGCGACCTCCTCCAGGCCATCTCCCATGATTATAGCATGATCGCTGCGTCATGGTGCGACG
GCGACATCGTCAACATGGTGTCGAATGCCGACCCATCTACGATTACACCTGTTACAAGAATGGTGGGCAATTCGTCACAAGAATTTGCTGCTCCGACATG
CATAGGTCAGTACAACCAGAATATGCAAGGGGTGGACAGGTTGGACCAGATCCGAGGCAGATTTTCCATTGCAGATGGTCACTCCTTCAAGAAGTGGCAT
AAAAAACTTGCCTTAGCAATGATAGATATTGCTCGATCAAATGCGTATTTGACGCGGCGGCTAGCAGGAGTCGGTCCTCCTGCGCGTGATCCACATCGCG
AATTTGTCATGGATTTGGCGTGTCAGCTCATGAATGGCAAGTGGATCGAAGCTCCCAGCGAGGGTCGTATGGTGTACGGAACTAGTTCACTAAACGATGT
CGTGGATGTGGAAGGCGTTGTGCCGACGCCAGTGTCGACCCCCAGCGCGAACGTTCCCGTCCAGCGATGCACTGCCGTTGCCTCGAAGCAAATTCACAGC
AAGAAGAGCCGGAAACGACGCAGATGTGTTGTGTGCCGCTGGGAGGATCGCTACCCTACAGAGGTAACAACATACTGCCTTACTCACAGTGTGTCCTTGT
GTCAAGAAGTAAACGAGAAGCCCCCAACGAGCTGGATGTGTCCACAGCAATCTTGGACATGTTGGGATAAATTTCACAGGTTTTATTTGCTCCAAGATCT
GTTCACCGTGAAAGGTAACATTCGCAGGGGCTCGTCTCTAGCTCAAGCTAAAAGCACTGCTGCTGAAAGTAATCCTACCAAGCGCAACCTACCTGAACCA
AGCCCAAAGCCAGACGTTGTGCGTCAAATTATCTTATAGCTTCTGTCGTCGGTGGGTGAGCTGCTGAAGCTGGCGCGATGCTGGCCAGGTTGTGCTGCTG
CTGGATGGGATGGTTGTGCCAGGTGATGGTCGGGATGATGGTGTGAATATGCTGTCGGCCAAGCTATTGGTGTTCGTGCAGACGCGTTCCTCGCAGTGCT
CAAGAAGTTTGTAGTATTGGTGGTTTTATCACTATCTTTTGTTGTAAATATAGATCGGGGTCAAATTAGACTTCCAGCTGCATTCAACCATCCGTTCGTC
GGCTAGCTTCCAGCGGAGACAGAATGGTTGCGAACATCTACCACTGTGTCGCGGACAGAAGCGAGCAGTCGCAACAATAATTCGTGCGTTTGGCATGGCG
CTAAGTTCTTGGGCTACAAACAGCTTTGCTGATTCTTCGAAAAGAAAGTAATTCGCGTAGATAATTGTAGCATCACAAGTTGGACTTCGTACAGATAGTG
CCACGTCTCGTACGTCTGTAGCCTTCATGACCACCTTCCGCAGAAGTGGGAATGAATCAGCATGTCTTTGAATGTGCTTTTCTCCGAGAGTACACAAATC
AGAGCGAACTTCGACCCCAACACATTTGCTGATGCAGGTAGTAAGAGCAACTTGAGCTAGTACATTGCCAATACCAGCGCCCACATCAAGAAAGATGTCA
TGCGTGTTCAATGGCCCCAGAGCCGTGATCATGGCAGCAACCCCGGATGGCAGCAACTCCCCCGCATTGTCTTGCGTTCTACCAGCGTCCTGGCGAATGT
CTCCCGCAGTAATATTGCTAAATACCGAGGTCAGGACTCGTATTGCGTCATGCAGCGGGAGCAACGAAGAGCATGACGTCGCTGGCAATCGGGGAGGAGC
CTGAAGTTCCAGCACTGCGCTGACCGACTGCGTTCCCAACGCATTACCAGGTCTCTTCACCACTGCGCACGCCGACGGCTCCAACGCGCAGATCAACTGC
TCCATCGCCGGAGTGATCGACGAATCCGACGCGCCGCCCAACTGCTCCATCACTGCACTGCTCGACGGCTTCATCACCGCAGCCGACCGCTTCGTCACTG
CGCCCATCTGTCGCCTCACTACTGCATTGCCTGATGGCTCCACCTTCCGCCTCACTGCTACGCTTCCTGA