Description :
From Genome Similarity Track
Location :
contig_38:147647- 159581
Transcript NameFunction/comments
g8709.t1hypothetical protein
g8710.t1hypothetical protein

Sequence
11934 bases(100 bases per row)
GCGATAGGCAGTGCTGTTACTGTTCCGGTTCGGGCATATAATCCTGCCGAGCTGCATCCATCAAATGACCCTTGAGTGTTAACTTCGGTGCGGTTCCACT
TTTGTGATGTAACGGAGAAGCACCACATATCACACAAATAGGTTCCTGTCCGATTAACACCTCCAAAAATCCAAAGGTTGCCAAGATCGGAGCACATGCT
ATAGCTCACTCTTCCCTCTGGCAGCATCACTTGAAGATCGGGCCTTATATTCCCACTCGACAAACTACCTGATACATCTCTCGAAGCGCCAATATTATCG
TCGTGACACAAATGCCAAAGCCGGTCAAATGTATTGTACCGCCAGAGATCCGACCGAAATTTCTCTTCGCGATCTTGCCCGCCGAAAACGTACACACATT
CTCCAATAACAGCGGACGAACATCCGATTCGTGGGCCAGGATCCAGAGAAACCGAGCTAGGCAGTCGCGACCATGCATAATCATCGAGGGATAAGTACCA
GGCGTCTCCAAGGACCTCGTTGTCTACTGATTTACCACCATACATGAAAACGATCGCGTCGAGACGAACGCGAATTGTCGAAGCCGTATGGAACGCACGA
GATTGGGGCATTGAAGTTGCCGCCCCAAGAGCAGCTTGAATTAAAGTCCATGTCGGAAGAGCCATCAGCGTTCTTCGTTGTAGGGCATTTGTACAGATCC
ATATGCCGTGATGTTGCACAATTATTCTCGCCCCCAAGCACAAGGATCTGATTGTCATCAATTGCAACAACCTGGTGATTGCGAATTCCAATGGGTAAGT
CTGTCCACCTCTCCCAGGTGCTAGTTTCCGTATCGTACGCCCAGACGTGGTTACTTGGTTCAGTAGGCTGGGGCATTGGGGCATCCGCAATAACCATTCC
GCCGACGACAAACAACGTGCTATCCGCTAAAACTGATGCAGATCCTTCAAGTGCCGGTGGATGTATTGCTGTACCTCTTGCTGGCTCATCTGGAGGTGGC
TGAATTGTTGCGGTGGAAGAGGGCGTAGTTACCGCGCGTGAAATACTGTCAAATTCATGACCAATCGACGGGGGGTATGCGAACGGTTGGTGTCCTAAAT
TGATGCGGATGATTTCACCCGTTCAAGACTGATGCCAGGCATCATACCCGATCGCTTGTCGTCTACAGAGCACTTGAATTCAGAGTATGCGACACCCAGG
TTGACTCCATTTCGATAAAATGTCATCTCCTGCGTGTTTAAGTCCAGCAGGCAACCGATGATATCACCAGCTCTCCATTTCTCTCCGTATGAAGATGATC
CACTATTCCAGCGTCGCTGGCGGTTACCGTCGTACGACCATGAGTGAGCGTGATCTCCGACCCTTCACCTTGGTCTGAGCTTCCCTGAAAGTACCCATCG
ATCCACCCAACTTGAATCAAGCCACTTGTGACCACCTCTACCTCATAAAACCACTTCCCTCGAAATAACGACACACCGATTGTTGATATTGAACCGAAGT
TACTCAAGCCTTCGATCTCGCCAGAACGATCAATATCAACACGACCGCAGACTGACGTCACACAGCTTTGATCCAGCATAACGGTATCACCTTCATCATT
ATCGCGTTTTCGCTCCACAATCAAGGACGTGGTATAAAAACCAGCTGCAACATCCAAGCACCGACGGGAATTTTTCTCTGGTCGAACTTTCAGAGGAACA
GGCAATAATGCGTCTGCGCTGCCTCGATTTCCAAGTTGTCCCTTGTTATTCCGTCCGAACACGTAGACTTGGCCGTGTTCTGAAAGTAGCACTGTGTGAT
AGCACCCACAAGTCGCCCGCATCATTCGCGTATTGGCGGATAAAGCTACAACATTTGGAAGATTCTGGTGAATCTTGTTTCCGATACCTAGTTGCCCGTA
ATCGTTCCGACCAAATGAATAGGTTCGTCCACCCGTGGTGACAACAACCGAATGGTAGTAGCCGCATGCAACAAAGCATACCATTTCGTTCGGAAGTGTG
ACGATAGTGGGTATCTTAACTTGACGATTGTGAGCTAGGCCCAACTGCCCATAGTCATTCTTTCCGCAGGAAAAAAGTTCTCCGGTGGCTGTGCAAATGA
CGGTATGGTACAGACCGCACCCTACCATTGACACTTCAGTACCTTCGAAACTCTTCACAAGCTGCGGTGTGGATTGGTGCTGTGTGTGATCGAGACCAAG
TTGGCCACAATCATTCATGCCAAAAGTGTAGAGTTCCCCGGAATCCGTGATCACGGCGCTGTGGTGGTAACTCACAGAGGCAAACCCAAGCTTCTTTGTC
TTCAATGATTCAATAAGTTTTGGTACGTGAATCTTGGTGGCCAAGTTTTCATGCCCCAACTGTCCCCGGTCATTGTAGCCCCAGGAGTACGCTAGCCCAG
TGTCCGTTAGCGCGATCATATGCTCGCAACCGTTACTCGCTGCAATAGATTTTATTCGCTGTGAGCGCAGAGCTTGCACGGGGCGAAGCATCATTACCCT
CTCGTCGAAGTGACCCTGACCACACTGACCGCTTTTGTTCAATCCGCAGGTTAGTACGACTCCATCATTTGTGAGAATCGCCAATGTTTCGTTGCCACTG
ACCACCTGACGAATATCGTCCCACCCACAAAGAGCTACACTAGTGAGTTGATGCCGCTCAATATCATCTCCTGTGCCTAGTTCTCCGTACGAGTTCTGAC
CACAGCTGTACAGCTCACCTGAGGCCTCACACTTTCCATACATAGGCTGTTCTTTGAGCGCGGCAAGTTTGGCAATTGATGTCTCCAAATTCACTGCTCT
CGTTGGTGGCTGCTTCATTAGCCAAAGTATCACAAATAACATTGTCGCAAGCGATCCGCGGGCAAGGCCCACCTCTGCTAGCGTTTCGATCGTGCAAGCT
CCGATATGAACTTCACTTTCAGATGCTCCATCATCCACCGGGTATGCCAGATCACCTAAGCAGTCACTTAGCAAATTGAATGCTGACGATGCGGACGGTG
CGAGGTACATACTGTCCGAGTAGGCAGTAGGCTTCAAAGGTTTCAGGGTGGCCTTCACCATTTGCAGTGCGTGTTCGTACTGTTCTGGGTTGTTTTTGCG
TGTTGCCTTCAGTAGCATGACCACCAGGTCCCAGCCCATTGTCATGCAGTTCTGGGTCGGTAGTGGCAGCGGGGGGGGCGACACTTTACGCAGTGACATG
GCGTGAGCTCTTGCAGCCAGGAGTCGTTGTTCGTACCGGTATTTTTCCTTCTTCGTCATCTGGTACAATGCCTGCAAGTTTCTCACGTAACTCGCCACCC
GGGCGTCGAAAACGCCAGGCATCGCCTCACCCGCATCTCGCTTACTGTCTTGTCGTGCAGACTCTAGTCCGTCCTGGGACGGCAGCCCTGCCAGCTGTGA
AATGTGCTGGAACAACTCGTCCACCGAGTCCACGGAGCTCATGAGCTCCTTCATCTGCTGCTCGGGACTGCGTGTCTGCAGTCGCCCGGACACTTCACTC
TCTGTAGGGGCACAGAGGTAACATACACGAGGTCATTCCCTCGTTGAAGATTGAAATACTACCTACTAGAATTGCGTGTTACCTTTCGGTAGGTGCCGCA
GTGCGGCGCCAAACTCGAGGATCTTGTCCATTACATCTTTTGAGTCTTCGGTAGCGGACGGGACAGACACGTCGCCGGCTTTGAGCACGTCGCAGAGCGG
GACGTATGGCGCCTGGAGCGGCCGGAGCAGAGTGCGCTCGCCCGGCGGCTGCGTCACCGCGGCCGGAAGCGAGACCTGCTGCCCCATGACCCGTCGCCAA
CTCGCAGCTTGCTGTTGGTTGTCTGCTGTGTCTCTTGTGCCTCTGCGCGCCAGCTCAACTCGATCAGTGGCGAAGATCATCGGCCCGGCAGCCGCGACTC
TTCCGGCAAAATGTATCTTGTGTTCGATACATAAAAAACATGTTGATTGGTTGAAAATAATAGTGCTGTTATGGGCGATAAGTGTTTTGTTCCCTTAAAA
AACAAAACACTCGTTATATAGCCCGATTGGGTAACACGAGACTGTCCATTCATGCCCAACGAGGCCCGATCCTGGTGCCCGAATGTGCCCGACTAGGAAA
GAGTCGGAGAAGCATCGCGCGATGAGTCCTTCACTGTATACGTATAGCCGGACATTGGCTTGGAGCGTCGACTTGCATTTTTCAACCAAGAATCGCCACT
CCGATATAATATATACAAGTTGAAGGCATCGTGCAGCATGTCAACCTGGTCCCATGGGGAAGAGATTAGCATAGATAGAAACAGGTTCTCTTGAAAACGA
GGAGCGGTACCTTTCCCACGAGTTCTTGTACTGTTTCATCGCGTTGCGTCACTTCTCGGGCTTGAATCTACATCCAGACGCCACCGCTTAGCTGCTTGAA
TACCATTTCACGGAGAATTGACTCCTCACCTCAAGGTTGTTCTTGAGCTCTTCAACATCTGAAACAAGAGAATTCTGCAAGAAACACAGCAACAGGAACT
CAATCAGTTCAAAACAACAAACAGCAGTATGTAAGCCGTCGTACGGTCATTTTTGTCAATGACACTGCTGATAAGGACTTGGCGGTAGTCGCCACCCCCG
CCTTGGAGCTTTCTGTAGGCCGGCGCAGCGCCACCATCGATGGATCAGGTCCCTCGCCTGAGCTTCACACTCAGTCGGCGCACGCTATCCGTTATGTCCG
TTTTCCGGGCCATGCTGTCGAGTGCAGCCTGCGACGTGGCTATTGGTGGGCAGACGACTCGCTTTGCCGGTCTTCTCCGCCGCTTGCTGAATCGCTGCTG
GAATGAGTGCAAATGCGCCGCGGTCGTGCTTTGAACCATGGAAAGCACGTGGCTAGCGATGCATTCGAGCGGATCCGCACGGCAGAGTTTGTGGCTCGTG
TAGCTTCCTATCCGCATCAAAGTGGAGTCCACGATGGACCGCGTCGACGTGCAAGACATGGACTCGGAGACGCAGCAGTGCCGCACCCAGCTTCTTCTCG
ACTAGCTGCGCGGTTTCACCAACGGGACAGCTGCTGCAGCCTGCCGTTGGGCCGTCGTGTTAGCTATCAAGAGACTGTGCCAGAAAGAGACTCTGTCAGC
GGGCGCACTTACGATCAGAAGAACCCAAATCCGTCCTTCATCCCAGAGCAGCTCGAACTCACGTTTGATCGAATCAAGGTGCGCCTGAGCCGTGCGCGTC
TCAAACGTCTCTGCATGGCGGGCTCCATCGAACGCGACCGTGCTGTAGTTGCCCGTGCCTTGTAAAACAAACTGCCAGCTCGGAGTACCCGCTGCGGCAC
TGCTTCACCATCGCTTGACGCTACAGATGAACATTACCGCGGCTATCTATCTCAACTTGCCAGTTGTTTTGCACGGCAACAGACCACATGTGTTCGTCAA
ACTCAACGGCGTGTGCTCCAACAATAGGACCACGCAATACAACAGTATGTTCCCAATTCAACGTCATTCCCCCCACACTCCAATTGCAGCTTCCCATCGT
CAACATGTCTCCGTCGATAATCGCTACCTTCCAGTGCATGAGTCTGGGGCCTGCGTGAAATACGTTGACCCCGTTTTCGATCATCATAGGTGAGCTTTTC
TCGGTGACTTGTGCCCGATCAACGAGAACACGAACCGTGACACGCTGGGAGGCACGGATGATAGCGTCGGTCAGTTCAGGATGCGACAAGATGAACATAG
CGATATCTACTGAGGTCTCTGCGCCGTCGAGCAAATCAATGAGCTTCTGAGGTGCAGCTTGGTCGCGAGAAAACCAGTAGTCTACAACTGCAGTTTGTAG
TCTACCCAATATGTCCTGCTCCATGCGGCCAAATACTCGACGGTCGACCCCCATTATTTGCGATGTCCTTGAGCGATGGGTTTTCCGTGACGCTAAGACC
TCGTTTCAGCATTTCCACCACGAAACGCATGGGGGTCCACCGACAGGGTTTACCTGACTTGGACTCGTCTTTGGGCTGGGCGTGGACGATGGCGTCGATC
GTACCGCGGGCGTGTCCCGTGCTTTGATGCAGCTGGGTAATTCTCTCCCCTTTCTGGTATCGCATGCGAATCTGGGACTTCTCTGCTGGAGTTAGTCGCG
GACGGCGTTTCTTGGGCAGCGGACTTTGCGTTCTGTAGGCATTCGGCACGACGCGTCGCGAAGCAGTGTACATTTGACGTGCTAGGAAAAACGGAAGTGG
CCCGACCTCCGATCCTCCACGTTGACTGAAATAATAATGGCTCGGAAAGTCCGATCCTCGACGCTGCTGTTTAACTGGCTCGGAACGTCGCAAAGTGGGC
AACTTATCCTCGAGTCGAGGATAAGTTGCCCACTTTGAAATTTCCGAGCCAATTAATACAGCAAAAAAAAATGTTGGGCAGTGGGCAACTTATCCTCCAC
TGGAGTGTGAATTGCCCACTTTCCGACTTTCCGAGCCATTTAACCCTTTCGCGACGCCCTTGGATAAAGTATACTATACAAGGTCAAGATACTCCGATCT
AAAAGGGCACAAAATTCGCCCTTTAAGGTTTTCACGGTACTCGCGTGAGGCTTGAGTGCTGTTCACTATCCTCCCGGATGCGGGATAGAGAAAGCCGGAC
GGTCTAAAAGGGTACAAAATTCGCCCTTTAAGGTTTTCACGGTAGTTTCCAAAGACGCAGCGGATTGGCTCATATTTTTTTTTCTTGCGGCGACTAGACG
AATTCGACGATCATTGGTTGAAATGCAACGAAATTTACGCAGTAAGAAATCGCAGCCTTCGTAAAATACCATACCAGTCTCGTCTCCGCGCGATGACGCG
GTTGAAGCTGTGTACACGTCACTACGATGGCGACGCAAGCTAGTTGCCCTGGGTTAGCGAGGCAGGCAGCCTGCCGCAGGCTAGCCGTGGTCTGTGCGGG
ACACGTCGTATGGACGTCTAGTGCAGTGGGGAAAGGTAGCTTAGCAGAGGAATAGATAGACCAGAGAGTTGAGTTTACAAGGCTGGTTAGCAGAGATGAG
CGCTGAACTGCTGTGCGCTTGGCTATTATGAATTGTGAGTTTTACTGATTTGGTCTTCCATATATGCATCTGATTGGGAAATCCTATGCCTGTCTGTTCC
CGCTCTATCCATAAGCACCAATGGGAGTAAATATCTCTGTCTCACTATGCCGTTGACCGATTTACTCATCCAAAGAGACCCTGGGGTGAATTTTAGTTTT
TGGCGCGAACCTATAAAATGATCACCTTCCCAAACCGATTGGTATCAATTAGAGTAATGAATAAATGATGCATGGCATCATAACTCTATTAATTTATGCC
TTGAGACATAAAACCCATGCCGCTCGCAGGCCACACAACCGATTTTTCTCCCTCGCGGGGATGCCGAAGCGCGACCGCGATGAAGCGCGAAAAATGATAG
AGAAGCGTCCACGTCGACGGGTGCGCCACCTAGCGAGCGCAGCAAGCGATCTGGGCGGTGTCGTCGCATTCAATGACGTGTGGACATGGCTCAAGAAGTC
TGGCTGGTATTCTAAACCGCCTCCCAGACGTAGTCTGGACCTGCGCTATCGCTACGTTCGACCGGATGGTGATGCAGACGGTCAAGAAGGCGTCGATTAC
CTTCTTGGCGAGGCTGCTGTTCTTCGGTATGCTGCCGCCCTCACAAGTACGAGTCTTGCTTGTGTGAACGTTCGCGGCGGTGGTGCTAACGACGCATGAG
GGGTTGTTATGTCATCAGGGGGCAGAAACGACAACGGCAGCAACGAGCATGCCGAATCCAGGTCAAGAGTGGACGAAGATCGAGGAGGGCGCGAGCGCGG
GCGAGGCAGTGATGGCCGCGATGGCGGACATGGCGTGGCACCGGGTGCGTATCCGATTGATTCAAGAGTAGTGACTGCAGCTGATGGTATTTGTGCGTGG
TGGTGCGTAGCAGCAACAGGCAGTAACAAAGACGGCAGCGGTAATCTGGCGGCATCCAGGCCAAGTGTGGATGGAGCTCAAAACAAACGCGGACACGGTC
GTGGCAGTGGTGGTGGCAGCGACGGCGGACGTGGCAGTGGTGGCGGCGACGGCGGACATGGCAGTAGTGGCGGCGACGGCGGACGTGGTATTGTTGGCGG
CGATGGTGGACGTGGCATTGCAGGCAGCGACGGCGGCCGTGGCAGTGGTGCTCGCGCTCGTGGACGTGGAGGCGGCGACGGTGGACATGGTATTGTTGGC
GGCGACGGCGGACGTGGCATTGCAGGCAGCGACGGCGGCCGTGGCAGTGGTGCTCGCGCTCATGGACGTGGTGTTGTTGCTCGCGATGATGGATATGGTA
GTATCAGTTGCGGCGGTGAATGTGGCATTGGTGGTGGTAATCGTGGCAGTGGTGGCCGCGTCGGCGGACGTGGCAGTGATGAAGGACGTGGCGATGGAAT
GGGTGCGTAGTTGTCTTGTTGCCGTCTGCTGTTTAAGCATTCATCATGTATGTATTAATATGAATATTTGTATACTTGTTGTAGTATCAAGCGCTGTTCC
TGGGACGCCACAAGCCACAACTCGGGGGCAAACGCCCGACTCGTTACATCGGACCCAGCCAGCGAGGACACCTCCGATAATGCTGCAGGAGGTATACATG
AATAAGTTGGTGGCATTCACTCCGGAGCGCGAGACCTGGATGAAGTCCAAGCTCTACCGCCCTATCGGACCGGCATACATTGTGGGGCGTGTTTGCCGAC
GTCCGATGCGAGGAAAGTTTGCGTCACTGTTTGAGATCCGCTGGCTGGATACTCAGTTCCAGAACGCTGTGGAACATGTGAGTGTCGGATGTGTTCAATC
TGGAGTGGAGAACTACAAGGAGCTTACCCGGTTGAAGGACAACCCCGACTGGCAAGGGCTAGTAACGGGTGACGCCGACGATGACATTGACGTGGATGAT
GACGACAATTTGCAAGTGGTGGAAGAATACAGAGAATTTGATCCGGGTGTTTTGCTTCCTGCCAATATGGAAGAAGTCGAAGCGATTCGAAATCTGCGAT
TTGAGCCCAACGGAGAAGTTGACGCGCCGACTGACCTCTACCAGCTTGCCGACGGCTCAACGAAAACGACCCTTCTACCACAGTATAAACACCTGTTTGA
ACACTCGGCCACCTCCAGCTTTTTTGCGTACCTGCCTCTGTACTTCTGGCGCCAAGTGCTGTTTGAGACGAACAAGTATGCTATTGTGCACGACATCAAA
ATTGGAGCACCATTCACACTCGCGGAGCTGATGGCGTTTCTAGGCATCATGTTTTATATGGCCTTGAACGACAAAGGTGAATATGCGAACTACTGGGGCC
AACAACCAGAAGACCTGATATTTGGTGGGAACTCCGTCTCGCTGGATAGCGTGATGTCTCTAAGTCGCTTCAAACTTCTGCGGTGCTGCCTGAGTTTCAA
TGCTGTACCGACCACACTGGATCGTGACGCTGCTGCTCGTATCCGACCTCTACTAAACTTGCTGAAAGTGACTGGTGGTCTCTATGTCAAGGTTGGACGT
AATGTGGCTTTGGACGAAGCCAGTATAGCGTGTCGGGCTCGACAAGGAAGGCACATGATCGTGTTCAATCCCATGAAGCCAACGGGTAAATACCATTTTC
GGTTCTATGTTGCCTGCTGCTCATCTACCTGGATCGCTCTAAACTACAAGCTACATTGCAGTAGGTGTGATGTTGGCGACCGGCTCGATGGCGTAGTTGG
ACAGGAAGAAGCACTGTCGCTGCGAGTAGAATTTGACAAGGTGTCTAAGATTCGACAGCACGTGTTGGAGGTCGTGAGGCCATTTTTCGGTACTAACCGC
ATCATCAACATGGACAATTACTACACTTCGGTCCAACTGCTTCAAGAGCTGAAGCTCAAAGGTCTTTACGGTCGAGGAACCATCAAATCTAACAGCAAGC
ACTTCCCTCGTCACACGATCCTGGATGATTCTAAATGTACGCGCGGCGACCTCCTCCAGGCCATCTCCCATGATTATAGCATGATCGCTGCGTCATGGTG
CGACGGCGACATCGTCAACATGGTGTCGAATGCCGACCCATCTACGATTACACCTGTTACAAGAATGGTGGGCAATTCGTCACAAGAATTTGCTGCTCCG
ACATGCATAGGTCAGTACAACCAGAATATGCAAGGGGTGGACAGGTTGGACCAGATCCGAGGCAGATTTTCCATTGCAGATGGTCACTCCTTCAAGAAGT
GGCATAAAAAACTTGCCTTAGCAATGATAGATATTGCTCGATCAAATGCGTATTTGACGCGGCGGCTAGCAGGAGTCGGTCCTCCTGCGCGTGATCCACA
TCGCGAATTTGTCATGGATTTGGCGTGTCAGCTCATGAATGGCAAGTGGATCGAAGCTCCCAGCGAGGGTCGTATGGTGTACGGAACTAGTTCACTAAAC
GATGTCGTGGATGTGGAAGGCGTTGTGCCGACGCCAGTGTCGACCCCCAGCGCGAACGTTCCCGTCCAGCGATGCACTGCCGTTGCCTCGAAGCAAATTC
ACAGCAAGAAGAGCCGGAAACGACGCAGATGTGTTGTGTGCCGCTGGGAGGATCGCTACCCTACAGAGGTAACAACATACTGCCTTACTCACAGTGTGTC
CTTGTGTCAAGAAGTAAACGAGAAGCCCCCAACGAGCTGGATGTGTCCACAGCAATCTTGGACATGTTGGGATAAATTTCACAGGTTTTATTTGCTCCAA
GATCTGTTCACCGTGAAAGGTAACATTCGCAGGGGCTCGTCTCTAGCTCAAGCTAAAAGCACTGCTGCTGAAAGTAATCCTACCAAGCGCAACCTACCTG
AACCAAGCCCAAAGCCAGACGTTGTGCGTCAAATTATCTTATAGCTTCTGTCGTCGGTGGGTGAGCTGCTGAAGCTGGCGCGATGCTGGCCAGGTTGTGC
TGCTGCTGGATGGGATGGTTGTGCCAGGTGATGGTCGGGATGATGGTGTGAATATGCTGTCGGCCAAGCTATTGGTGTTCGTGCAGACGCGTTCCTCGCA
GTGCTCAAGAAGTTTGTAGTATTGGTGGTTTTATCACTACCTTTTGTTGTAAATATAGATCGGGGTCAAATTAGACTTCCAGCTGCATTCAACCATCCGT
TCGTCGGCTAGCTTCCAGCGGAGACAGAATGGTTGCGAACATCTACCACTGTGTCGCGGACAGAAGCGAGCAGTCGCAACAATAATTCGTGCGTTTGGCA
TGGCGCTAAGTTCTTGGGCTACAAACAGCTTTGCTGATTCTTCGAAAAGAAAGTAATTCGCGTAGATAATTGTAGCATCACAAGTTGGACTTCGTACAGA
TAGTGCCACGTCTCGTACGTCTGTAGCCTTCATGACCACCTTCCGCAGAAGTGGGAATGAATCAGCATGTCTTTGAATGTGCTTTTCTCCGAGAGTACAC
AAATCAGAGCGAACTTCGACCCCAACACATTTGCTGATGCAGGTAGTAAGAGCAACTTGAGCTAGTACATTGCCAATACCAGCGCCCACATCAAGAAAGA
TGTCATGCGTGTTCAATGGCCCCAGAGCCGTGATCATGGCAGCAACCCCGGATGGCAGCAACTCCCCCGCATTGTCTTGCGTTCTACCAGCGTCCTGGCG
AATGTCTCCCGCAGTAATATTGCTAAATACCGAGGTCAGGACTCGTATTGCGTCATGCAGCGGGAGCAACGAAGAGCATGACGTCGCTGGCAATCGGGGA
GGAGCCTGAAGTTCCAGCACTGCGCTGACCGACTGCGTTCCCAACGCATTACCAGGTCTCTTCACCACTGCGCACGCCGACGGCTCCAACGCGCAGATCA
ACTGCTCCATCGCCGGAGTGATCGACGAATCCGACGCGCCGCCCAACTGCTCCATCACTGCACTGCTCGACGGCTTCATCACCGCAGCCGACCGCTTCGT
CACTGCGCCCATCTGTCGCCTCACTACTGCATTG