Description :
From Genome Similarity Track
Location :
Scaffold_13:147606- 150007
Sequence
2401 bases(100 bases per row)
GAGTATGCAGACGTGTTCCCGGATAACATACCGGCTGAACTCCCTGCTGACCGTGGGGTTCGGCACGAGATTGATCTCGTGCCAGGTTCGAAGTATTTTG
TGACACGGCAGTGGCCGTTACCTCGAGATCAAGTCGAGGCTATTGACGAATTCTTCGAAGGACGCCGTAAGGTGGGTCACGTGCGTGAGAGTATCTCACC
ACACTCGAGTCCAACCTTCTGCGTGAAGAAGGCTACGGGAGGCTGGCGAATAGTGCATGCGTTTAACAAACTAAATGATGCCACTATTCCTGCTCAAACG
CCTATCCCCAGGAAGGACATAGTGTTAAACGCCATGTCAGGGAGCGTCATCTTTAGCACCATCGATCTAACTGATGGCTTTTACCAGATCCTGATGAGAG
AGAGAGGCATACCACTCACAGCAGTTAGCACCCCGAGTGGCATGCTATGGGAATGGCTAGTAATGCCACAAGGGTTGAAGAATGCACCTGCCACTTTTAA
TTGCATGGTGTCTCAGGTGCTGAGAACATTACGGGACTTTGCTCCCAGTTACTTCGACGATATATTCGTCCACAGTCGCGCTGAGGGCGACCTCAGCGAG
GTCCAGGTTCATCTTCAGCACTTGAAAAGAGTATCCCGAGTCATGCGGGAGAACAAGCTCTATGCGAATCTCAAGAAGTGTTTCTTCTGAGCACCGGAAA
TTCCGGTGCTGGGTTGCTATGTGAGTAAATTAGGCGTTCGAGCTGATCCAGAGAAAGTTTCGTCCATCTGTTCTTGGCCCACACCCAAGAACCCCACGGA
ATTACGTCAGTAGCTTGGCTTGGCTAATTACTTGCATAAGTATACAAAGGACTACGCCGGTTCTATACAGCCTTTTTCGTCCTTCTTGAAGAAAGACGCA
ACGTGGTCGTGGCGTCCTGAACATCAAGCAGCCTTCGACGCGGTGAAGAAGAGCCTGGCGTCAGCGCCAGTGCTGGTCCTACTGGACGACTCCAAGCCAT
TTCACGTCGTACGCGATGCCAGGGTTTTCGCGATTGGTTGTGCCAACATGCAGTTTGATCATGAGGGCCGTGAACGGGTCGTGAGCTATAACTCACGACA
AATGAAGCCAGCGGAAAAGAACTACCCAGTTCACGACAAGGAGTTGTTAGCGATGCGCTACGCACTCATCAAGTTCCGTGTTCACCTACTCGATGAATGC
ACGTTTGCTTTGTACACTGATCACGCATGGCTGCGCATAGCGATGAAGAGTCCTCACCTGTCCCAGTGAATGGCACGGTGGCTTTCGTTTTTCTCCGAGT
ATAATTTCGTCGTGCATTACAATCCGGGCGAGAACAACATTCTTGCCGATGCTTTGTCGAGACGTACCGATTATGATCCTCGGACGGCGTTGATTCATCA
GGCGACTGAAGACGACGAAGATGATGATCGTTGCGCGATGTGTGTGTTGCTGAACTTAACTCGGGTCAGTCCCGAGCTGTGCTTATTCGACTAAATCGTC
GCGGCTTACGCGAATGATCCAGACTACGCCGATATAATCGCTTATCTGCGCGCACCCAGTGACGTTGCAATGGGTGCTCTTTCGAGAACCAAGCATGATC
ATATTCTGCAATATAGTTTGGACGGGGACCTAATCCTGTACAGCATCGATCAATCCGGTGCTCCTCGTACGGTGATCGCCAACGACATGGATTTGCGCGC
TCGAATTATTCATGAGTACCATGATGCTCCAACTGGTGTTCATCTCGGCCGCGAAAAGACTTTTGCGGCTGTGTCTCGCGACTTCTCATGGCCCCACATG
TACAAGTGGGTGCGCAACTGGATTCGTACGTGTGAAATCTGTCAAAGAGTGAAGCCATCTCCATCGTCGCAGGCTCCCCTGCGACCGTTGCCAATAGCAA
CTGAGGCTTGGCGCTTAGTTTCCATGGATTTTATCTTCGCGCTAGCACCCGATATTCAAGGCAGAACGGGTATTCTGGTATTCGTGGACAGATTTAGCAA
GATGACACATCTGGTTCCTGTTCATGCTAAGGTCACCGCGGCAGAAACCGCGGTGTATTTCATCGACGATGTGTTTCGCAATCATGGATCGCCGGAGAAC
ATTGTTTCGGATAGCGATCCTCGATTCAAATCCGCGTTCTGGACGTCACTGTTCGAGCTTCTCGGTACGAAACTACGTATGTCGACAGCGGCCCATCCGG
AAACGGACGGGCAAACCGAGCGAGTAAACCGAGTACTCGAAGATGTTCTTCGAAGTTACGCTATGTCCTTCACGAGTTGGAGTGCGTTCCTACCACTTGC
TGAGTTTGCGCTCAACAATGCTGTACACACGTCAACAGAGTTGACGCCATCTTTTGTGAATTCGGCTCGACATCCTCGAGTTCCTACCCTACTCGCCGTG
G