Description :
From Genome Similarity Track
Location :
Scaffold_110:14760- 16823
Transcript NameFunction/comments
Phyta_totarag3783hypothetical protein

Sequence
2063 bases(100 bases per row)
TCGAGGCTTATCTGGACGCCCACGGCTACGTCAAGACGCGGAAGTACCTCAAGGGCAAGTTCCTGGGCAAGGTACGGCATGAATCTGCTGTTGGTAACtg
gttgttggtgctgactTACTGTGTAGGGAGGATTTGCACGTTGTTACGAGTTAAAATGCGAGCAGACTGGGAAGATTTACGCGGGCAAAGTGGTGGCCAA
GAGTTCGTTGGTCAAGCCGAAGGCCAAGCAGAAAGTGAGTGAGGGAAATGCCATGGGGGTAGGAAGAGAAGGAGTAGACAGGTGGCTGAtgcagtttttt
ttttcttctggTGCTGTACTTTCTCGGATTTTTTTTGTAGTTTACGTCGGAGATCAAGATCCACAAGTCGCTGCATCACCCGCAGGTTGTACAGTTTGAG
CACTTCTTTGAAGACTCGGACAACGCCTACATTCTGCTGGAGTTGTGTCGCAACCAGTCCATGTCAGACCTGATGCGACGGAGAAAGCGATTGTCCGAGA
GCGAAGTGAGGTTTTACATGCGGCAACTCGTGGAAGGACTGGCGTATCTGCACGAGACGCTGGTGATCCATCGCGACCTGAAGTTGGGGAATCTGTTCCT
CACGTCAGACATGCGCCTCAAGATTGGAGATTTTGGGCTCGCTACTCAACTTGATAGCCCCGAAGATCGCAAGCGCACCATGTGTGGCACGCCCAACTAC
ATTGCGCCTGAAATCCTGAGTGGACAGCGTGGTGACGGACACAGTTTTGAGGTCGACATTTGGTCTACTGGTGTTGTCATGTACACGCTGCTCGTGGGAC
GACCACCTTTCGAAACGGACGATGTCAAGGCCACCTATAAGCGCATCCGTGCCAATCAGTACGACTTCCCGGAGACAGCGCACGTTTCACGTTCGGCTCA
GTCGCTTGTTCGCGGTATCCTGCGCAGTGACCCGGGTGCACGACCATCCCTGGAGCAGATTTTGAAGCACCCGTTCTTGGCTGACGAGTTCGTACCGACA
ACACTGCCCAGAAGTGCGCTACTTGTTACACCTCCAGCGTGCAAGAATCAATCTTTCGCTAACCGTCACAGTGACAGCGAGCGTTTTGCAAGCTCGACTG
GAGTAAGAGTTCCGCCACCGCCTGCAGCATCGAAGAGGTATCCTCTTAAGACACGAGATGTTAATACTGACGCTCAGCGCGCTTCTTATCCTGGGACATC
GTCTTCGCTGGCGCAGTCGCTGCCTCCTTCTTATAAGCGCGACGGATCAGGAAGAACATCGGGGGTTTTAAGCACGACCAGAAGACATTTGGCAGCTAGT
AGCACCACAGTCGAACGATCGTCGAACACGGGGGCAGTAGAAACCCCAGCTCCTTCACAAAACGTACTGGAGACGGCATACAAGGCACTATCCCGGTTCT
TTTTCCTACAAGAGCACAATCGCAATGGAAATGACGGCGACCAGAGGTTGAGTGAATCATCATCGGCTGTCAccatcgttgctgcagcgcagagACTGAA
AGAAATCCGCGCTGAGGCTGAGGAGATCTGTCCTCTCGTCCCTGCCAGCCTGTGGATATCTCAGTGGGTAGATTACACGTCCAAGTATGGCATCGGCTAC
ATGTTTTCGAATGGTGGATCGGGTGTGTACTTCAATGACTCCACCAAGATGATTTCATCAGCAGACGGCCGGGTATTCGAGTACATTGAGCGTCAAAGCA
GCCATAGTCCAGGTCCAGAGCCTCGAGCCCGCTACACCAAGGATAACTACGACCCGGCGCTCAGCAAGAAGGTGACACTACTAGGCCACTTCAAAGGCTA
TTTAGTGGACGCCCGCGCGGAGAACGACGAAGCGGATACTCTTGAAAGCCAGCTTGCACGATCTTTCGGGATTGGTACGGATACCAGTGTACGTGGAagc
agcgatggcgatggagcAGCCCAGTCGATGGTGTTTGTGAAGAAGTGGGTCAAGACACGTCATGCGgtgctgttccagctctCCAACGGAACAATTCAGT
TTAACTTCTTCGACAAATCGAAGCTCATGCTATCGGCAAACGCTCGCATTGCAACGTATCTGA