Description :
From Genome Similarity Track
Location :
Scaffold_1110:1476- 7759
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1110-fgenesh-gene-0.1Conserved gene of unknown function
Pytir_DAOMBR486snap-pir_contig_1110-abinit-gene-0.14ATP-binding Cassette (ABC) Superfamily

Sequence
6283 bases(100 bases per row)
CGAACAATCGACCAACAACATGGAGAGCACCACTACCAACAGCATGAAGAGCGCCGCCCTCTTATCGACGTCCACGGTGGTCGTGGGCACGCGCATCCAC
TGGAGCAACCACACGCAAGCGGACCAGCGCATCCAGGTAGATAAGACGCTCGCGCAGGTGCACGCGTTCTGCGCGCGCGCGGTGACGTACGCTGACAGCA
TCCTCATCGCCGTGGGGCTCCCGCAAGCGCTCGCTCCATCCTCATTCGCTTCCGCCACGACAGAGAGCGCCTTTGTCGCCTCCGTGCGCGAGTTTCTCTC
GCGACTGCAGAGCGAGACCCGCGGTGGCGTGAGCGTGGTGAATGGCGACGCTGATGCTGATGCTGATGGCGCTACAACAAGGATCGTCCGTGTGGAGATC
ATCCCGATGCTCCACTGGGGGAGCTTCGTGCCGGCGCTGAACGCGATCATCTCCACCGCTGCCACGCAATTCCAAAGTGCGATGCTGTTGCTACTGCAGT
CGCTGGAGATCGAAGTGGACGCTGCAGGTGTCCAATTTCTCAAGACACGATTCGAATTCGGAAAGGATCTGGTGGTCGGCGCGGCGCTTCCCGGTCACTC
GTTCCAGCCAAGTACCAAAATTGATGCTGAACTAGAGCTCAATGGTCTCACGGCGCCCTGGAACACGCTCGCGATCTGGGATCTCACGCGCTTGGCGATG
GTCGGGTTCCCACTGATTGGCGACGGCTTGCGAGTCAACCCAAGTGGCTCTACAAGCGCTGCAGGCGTCGAAGAGGTCTCGACTATCTTGCTCTACCAGC
AGCTCTTTCCGAGCGCCAGCACGGCGAAAGTGGTCAAAGTGCCTGGGATCGCGTGGCAAGTGGACAACTTCGAGAGCGAGGAGCGCCGCACCTGGCAGGA
GAAGAAAATGACGAGCAAGCTGCAGCGCGCAGAGAGGCAGATGGAGCACTTTGGACTCGCGAGGGGAAAAGTGCTGCATTTGCAGTAGAGATAATGAATG
AGACTAACCAGATTAATTGCTTACAGATACCTTAGCGTTGTGTTCCTAGTTAGCAGCTAGTGATGGTGGTGCTGCTGAAGCCCAGAGCCCCTTGGTGACC
CGTGTCTCTTCCTGCTGCTGCCGCGCAAACGCGTTGAAAATCTGCTCGAGACTCGTCTGCGAGATGCTATACTCCTTGATAAACAGCGTCTGCGTGCCTG
CTTCAATCAGCTCAAACATGCGTGAGAGGCTGAAATTGGTCTTTGTCGTTGCTGGATTGCTTTCGTCACTTATTAGGAGGTCTAGTCCTTCCTTGTTGCT
GAGCTTGTAGCGACAAAAATCCGCCTGGCGCTCCAGCAAAGTCGTGCTCTCCCTGCCAAAGTGTGTCTCCAAGTACAAACTGAGCTGTTCCACGCGGTCT
TCCAGTAGCCACCAGCTGCAGAACTCTCGGGTGCTCAGCATCCCACCACCGCCTCCAGTTCTGTTCAGCTGAAGCTGCAGAATAGATCCTGTCGGGTGCT
GACACGCAGCTTCGCCAACGATCCAGTGTACTCTCTCGGGTTTCCCAAGTGCAGCACACACACCCAAAAGCTCTGCAGATGAGATGACACCACCACCTCC
AGTGCTACTGCTGCTAGCCGATAGCTTCTCAAGCAAACTCAAGGTGTCCTCCTGGCTCGGTGCGTGCAGCTTGCATTCGAGCAGAAAGCCATCACCGAAG
CGCGCTTTCAGATGCGGGATGCTGCCAAAGCAGCGCAGCTTCCCGCCGACCATGATCGCGGCTTTGTTGCAGAGCGCCTCGCACTCCTCCATCGAATGGG
TCGTGAGCATCACCGTTGTCTTCCTCGAGCGGACAGACACCTGGAGGATCACGTCCCACATGAACCGTCTCGCGTGCGGGTCCATCCCGGTGGACGGTTC
GTCGAGAAAGAGCAGATCCGGTGCTCCGAGCATCGCGATCGCGACCGAGAGCTTCCGTTTGTTACCACCACTCAGGCTTCCCGCGAGTTTGCGCTCAAAC
GCCTTGAGCTGGAGTTTGAGGAGCAAACGGTCGACCTCTTTGCTTAGCAAGAGCGAGCCAAAGCCCTTCATGCGTCCATAGAACTCCAAGTGCTCACGCA
CAGTGAGCAGCTCCAGGAGCGCGTCAAACTGCGGACAATAGCCAACACATCCTCTCATCTTTGAGCGCTGCGTGAGGATGTCGAGTCCATTGAGCTTTGC
AGACCCAGAAGACGGCAGGATGTCGCCTGTGAGGATCTTCATCGTCGTGGTCTTTCCTGCGCCGTTGATGCCCAGAAAGCCAAAGCACTCGCCGCGGGCG
AGTCCGAAAGAGAGGTTCGAGACCGCTTTCTTGCCGTTCGGGTACGTCTTTTGGAGGTTGAGAAGCTGGACGACTTCTTCTTGCTCGTCTAAGGTTGTAC
GAGCTGGTTTGGATATGTTCGCTTGGAGGGCCCGTCGAGCTTCGTTCGCAACATCTTCGTCTTCAGGACACACCTCGACAGACTCTTCTTGCACGTAAAG
CTTTGCATTCCCTTGGCAGCGCCAATACTGAAACAAATGACGAACCCAGTTGACAAGCAAGAATGGTCCTCCTGGACTTCCCTTTGAGAGAAAGCTGACT
TCGCCCGTCTGGATCCAGTCGATGATAAGCGCCAACAGAAAGAAAATCGGACCTTCGGCAGCGAGGTACGTAATCTCATTGCCCGCAATCTCTGGATCGA
AAGCGCTATTTGCTACTGTCGAGAGTCCGTAGAGCACTTCGATGTCCGCGACAATCACGCGCAAGAGCCCATTTCCGAGCGAAAACAGCGGCGAGCAGCG
CCAGAGGAAGATCAGCGCTTGGTTCGCTGCTTGCGTAGAGGTGAGCGAGTCGAGCGACACGCTCATGATCATGAGCAACAGTCCCAAAAAGAAGTTGAGC
ATGACTGTGTACAGCAAACACGCCCCCGGGTCCTTCATGAGGTGTGACATCAGGTACGTCCATGGAGCGATGGCCCCGCCAAAGAGAAAGAACAGGCTCA
GCACTGCCTCGGGAACATCGCGCGTGCAACCCTTGCAGCTTGCAGTTGAGCTGTTGCTGTTGAGCGACGAGGTGATTCCGTACCCTCTCAGCAGCAGGAT
GGCGACCGTCATGGGAACCAGGTACAGCACATAGTCAAATACAAAGTTGGCGAGCCAGTAGGCAGCGAGCGAGACGCCCGAAAGTATCTGCTGGTGCTTG
GCGTTCTGCTCGTTCTGCTTCTCCTTGACGAGGAACGGCATCATGGCGGCGGGGATGAACGTGAACGCGATCACGACGAAGATCACGGCGGGGAGGCTCA
GGAACGAGTTGAATATCGATCGTGTCTTGAACGAAAGCGGGAACGGATGCGTCGCCACGCGCACTGTGCGTGAAATACTGTTGTTCAACTGCGGCTGCTT
GGACAGTAGAAAGCGATGGATCGACTCGTCCATCATCGCTTTGAACACTGGTCCTCCATGGGTGGACGACGAGTTCACCATCACGTTGTACCCGAGAACT
TGGTTTTCCTGCGAGCCATGGAGCACAAAGCCTCCATTTTGACCCTTGACTGGTGGTACCTGGGGTTCAAGTGTACTTGTGTTGTGTCCGTAGCTTTTTT
CAAACGCTAATTCGCCAAAACGCAGACAGAAACCAGTTGTATCATTTGGCTGGATCGATGGGTCCGTGTAGGACACGCCAAACACTGTTGGGGTAGTCGA
AGACGCATACACGATTGGCTCCATCTCGAGCGGAAACGGCGCTCCACCAGTGAAGTACTGCGGGTTCAAGATCGCTGAGCACCATGGATCTATTAAAGTA
GATGACGAACCCCCGGTACAACTATATGGGATCGGGGTCTTCACGCCCAAGTCATACTGAGACACCGTGTCCAGCATCACTTTCGGGTCATTTTTGATGA
ACAAGCTCACTTTGAGAGCCGAGAGCCCGACGAAAATGACTACGATCGGTAGAATCGTGCTAAAGAAGAGCATGCTCCGGTCTCGTTTGGCGCTCAGCAC
GCGCTTGCGGAGCAACGCAGCGAGTTGGATGGCGAACCACGTGAGAAACGACCGACTCCCAAGTTGTTGGCTCGGTACCTCAGTATCGTCGTCGTGCTCA
CCGAGGGCTTGTATATCAGTGGATGCCTTCGAAGTATCGGGGGCGCCGTTTTCCGTCTGCTTCCCCTCTGCGACCCGAAGGAAGATCTCTTCAAGCGTGG
TGACGGAGATCGCGAACGACAGAATCCCAAGCGCGTGCTGCTTTGCCTCAATCTCCTCAAACAGCGCTGGAAAGCGTGACGAGCACTCGAACGGTAGCTG
GAACGTCAACTCTGAGCCAACATCCGTGTCTACGCGTGCCTCTAGAACGTGGTGGACGATCAAAGCGTGCAACTCCTCTGCATCTTTGGTGTTACTTTTC
TGACTGGTCTTCTGAGCCTGCACAAAGCTCAAGCGATACCCGACGCCAAAGCGCTTCTTGAGAAACAATGAGGACCCAACGCACTTGAGCTCACCTTCCG
CCATGATCGCGATGCGGTCGCCAAGGATATCGGCTTCGTCCATGAAGTGCGTGGTCAGGATCAGCACGCGCTCACGTCGGTTGGCTTGGATCAGCTCCCA
CGTGCTTCGTCGGCTGTAGGGATCCATCCCCGAAGTGGGCTCATCGAGGAACACGACGCGACTCTCACCGAGGAACGCGATCGCGAGCGACAGCTTTCGC
TTCATGCCACCAGAAAGCGTATGTGAGAGCACATGTCGCTTCTCCGTGAGTCCGACTTCTTCAATCTTCTTCTTGACCTCGGTGGACAAAGCACTAGGGT
CATTGAGCCCCTTGACGCGGCCGTAAAACTGCAAATGCTCTTCCACTGTGAGCTCCGGGTACAGCACGCTGTGCTGAGGGCAGTACCCTAGCGACTTGCG
CACGCTGTGCATGTCGCTCGCGACTGAATTCCCGCGGATCCATGCGTCCCCACTCGATGGTGGAACCATGCCCGTGAGCATCGACATGAGCGTCGTCTTC
CCTGCGCCATTGTGACCAAGGAGACAAGTAATCTGTCCCTCATAGAACGACAAGCTCAACTTTTTGACCGCAACTTTCTTGCCCCCGGGCGTGTCAAACT
CTTTCCGCAAATTTGTGATCATGACAGCTCGTCCATTAAGTTCTTGTTGCTTCATTTCACCGCTCACAGGCTCACAGGTGTCTTGCGATGGAAGTTCCTC
GGTGCTTTCAGGTATACCCATTTGGCCTCTCGACACTGGGCGCATTGCTGTCTTCTCAAACTGTGAGCTTGGCTTCCTACCTGAACTCCAGCTTAAAAGA
ATGCGCCGCCAGCGAGCCCCAGTGAGGCAAAAGTACCACTTCTCACTCACGCCAAACTCGCGCGGCGTCACCCTCTCAAAGTACAAACCGAGCAGCACGT
ACACGAAGAAATCGAGAAGTTGCATCCAGATCGCGTTCACAAAGCGAAAGCCGTCGACGATTTCGCTGGCGTTGACAGAATTGAGACCGACACCGACCGC
TTCAACCTGCGCGATGACGTTGATCCCCTGCGCCAGCGCCACGGGGGACAGGAGACACGCCCAGGTGCGCTCGATCTTGCCTGAGCTGTCGCTGAACCCG
AACGAGGCGAAGAACATCATGAAGAAGAGCCCCATGCCCACGAACGAGCCCGCGCGAGCCCGCGAGAACAGACTGCTGATCAGAAACCCGTACCCGAAGC
TGCTCAGCGAAAACGAGAAAAAGAACCCAAAGAGCAGTCCAAAATCCGAGTTCTGGAACAGCAGTACTCTTGCACCGAGGGTTTGAAGCAGAGACGCGAC
GAGTAGCAGGCACAGGTATGTTATGAACCACGCAAACAGGATGTACTTCTCGTCCACGCCCAGGATGCGCATGAGTTCTCTCGACCGGGTCTCTTTCTCC
ATGAGCAGTGCGACGATCACCCGCGAGACACTGTACAGGTATGAGAGAATGAAGCCAACGGGGAACACGATGAGGATCTTGTCGAAGAAGCCCGCGTAGT
GGAAGCCCTCGATCGGACTCATGAACGTCGCAGCGCCGTGGAAAGCCTGAGGCGCCTGGCGAAGACTTTGCAGGAGCTTCTCCTTTGAGGACGCTGGGAC
ATCGTCGACTGAGATCGATAGGTTGCTAATAGGGCCCATGTGCGCTGTGACGATCTCGCTCAGCGAGCTGCTCGCGAGAACAACATCTCGAATCCCTTCT
AGCGCTTTCAACACCGAGTCGATGATGAAATCGTTCTTCAGCTGCTCTAGCAGTCTACTGTCCAGCTCCGAGCTTTTTTTCAT