Description :
From Genome Similarity Track
Location :
Scaffold_1960:1476- 3438
Sequence
1962 bases(100 bases per row)
ATTTTCGCCCCGTACAACGTTCGCCGTCCGCTGAGCGGGATCCGCATCGCGTCAGGGAAACAAAGCGTCCCATCAGCCAGATCCAACTTCACTCCGGCTG
GTACCGTGAAATCCCTCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATATCAAACCAGTACACCAAACAACCTGCCAGCGTGATCTTGAT
CCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTCACGAGCAAAGGCG
GTATCTATTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGGTCTTGCCCCCTACTTTGGCTTGTCGGAACCACTTTCCTG
GGGCATGGTACTTCCAGTATCCACGGGATTCTCCTGTTAGCAGATACCACTGGATCCCGTGGGTCTGACAGACCTTAGGTGGATCTGCAGTGACCACACC
CTTGGTAGGATCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATGCAGGGTTGAAGAGACTTCGGATGTGGCA
AATTCATCCACTTGGCGCAAACTAGAAATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTTCTACCTGGTTCTA
GCGATGTCTTGTTCACAAATGCATAAATACAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGATCGTCCTAGTTTAACATCTTCATCCCT
CTGTGCTTCGCTGGGTCAAACCATTTGCGGATCTGGCTGTAGAATACTTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACAACCGCGACATACGT
AGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCTGCGTGCTTCCGGGATCCGCACTGCGA
ACACCTGATTGGCGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCCGGTACGGTATCCCCTGATCAAGAGTTGTCTCCGGTCTTC
GCCGTTCGATCGTTGGATGCAGTGAGACATACTCGACGGTAATCCTCTGGGCCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGACGCCG
TGACTTGGTGGACACGTCGAGCTGGAGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCATTCTTCTGGCGGTGTTTCGCGCG
ATCCACAGCCCGCAGCACACTGCTGTAGACTTGACTACTGTATGCAGTGGTGAACTGATGGCTGTGAGCAAGCGCAGCTTGCTCACTACCATGCTCGCCG
CAGATTGGATCGAGTATTAGCCGCGCGGCTCAAAGTGGGAGATCTGACGCCTCTTTTTTTCGTCGGACAGCGGATCTCGGATGCCGGCTGCTTGTGTGTC
TACACTTGTCAGCTGATTAGTGAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAACGTCTCGATGAAATGATCCACATGTTTACGTAGTACCTTG
GATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGCAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCTAGCATGGT
AGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGGAACTGCGCAACAAATCTGGCCACTTGTTCCTAGTGGATCTGCCCAGCTGCCG
ATACCAATTTCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCGGCATCCGAAGCTTAATCTCTCATGAGGGCCGACTTGACTTTGCTG
ATCCATGTTTTCGCTCGGTCCTCGTCGTGATCCTTGCCCGTGAACTCCTTCAGATCCGATAT