Description :
From Genome Similarity Track
Location :
Scaffold_8:147508- 148771
Sequence
1263 bases(100 bases per row)
CAAAGCCCGACTTGTCGTCAAAGGGTTCATGCAACAAAAAGACATCGACTACACGAACATTTTTGCTCCTGTTGTACGACTCGAAGTTTCACGCTTCCTT
TTTTCCTTAGTGGCCATCCATGATTTGGAATGCGAACAAATTGACTTCAAAACCGCCTTCTCTTAATGGCAAAATCGACTGCCCTATACGCATGGAACAG
CCTCCTGGCTCCCTCATCGACCCTGCTTCTCGGCGCCACTATGTCTGCCTCCTCCAAAAGAGCCTTTATGGGCTCAAACAAGCCCCACTCTTATGGTAGT
GAACTTTTGTCACCTTCATGGCTTCCTTGGGCTTTGCCCGTCTTCACAAAGTCCGCTGTGTCTTTCTCAAAACCAGCGACGATGGTTTTACCATCGTCAG
CCTCTACGTCGACGATCTCTTGATCATCACTCCGAACAAAGCTCTTGCCTCGGATCTCAAAGCGTCATTATCGAAGCGCTTTCACATGAATGACTTAGGT
CCAGTTCGAGATATTCTCGGCTGGGAAATCGCCCACAATCGTCCCAATCGAACTATGTTCATCCACCAATCCCGTTACTGTTCTACAGTACTTGTTCCCT
TCGATATGTCTACGTCGAAGGCCGTCGCCACACCTTTTAAGTGCACTACGCCCCTATCCAAGGCTCAGTGTGCTAGTACACCTGAGGACATTGCTTTTAT
GCAAACAAAGCTGTATCGGTCAATTGTTGGCAGTATTATGTACTTAGCCATGGCTTCTCGGCCTGACTTGGCTTATGCCCTTCAACAACTCTCGCAGTTA
CTGCACAACCCGGGTCTTGCCCATTGGCGTGCTGACAAGCGCGTTCTACGATACCTCAGTGGCACCTCTCTTGCATGGGCTTATGCTCGGTGGCCGGGAC
TATGTCTCCAAGCCATTTCTCTCCGCTTATGTGCATGCTAACTACGCCATGTGCCCAGACACTCGTCGATGTGTCAGTGGATTTCTGACCCTGTTCTTTA
ACAGCCTTATCTCTTGGTTATCCAAGAAGGAAGGCATTGTGACTCTGTCAACCACCGAGGCCGAGTTTGTGGCTCTTGCCTTTTGCATTCAAGAATGTTT
ATACATTCGACAACTCGCTGCCGAGCTACATCACACTAGTGATCAACCGATTTCGGTTCACGAGGACAACCAATCCGCCATCAGCATCGCTCAAAATGCT
GAGCATCATGGGCGCTCCAAGCACATTGATGTGCGTTTTATGTTTGTTCGGGATCTCGTTGAG