Description :
From Genome Similarity Track
Location :
Scaffold_1797:1475- 5501
Transcript NameFunction/comments
Phyta_totarag13672hypothetical protein

Sequence
4026 bases(100 bases per row)
TCATCTCCACGACAGACGAGGTGACGATCGAAGATATCAAGATAGGCGATCTGGAGTTCAATACCCCGGTGGAGATCGATCGACTGCGTAAGAAGATCTG
ACGGAGGAGACACCTCTTGATCGGCAAGGGCAATGCACTGCCACCGGCAGCCCGAGGTGTTATGTGCAACATCGATGTAGGAGACGCAAGGTCGATCGCG
CAGCGAGTGTGGAAAGTGACACCACGATTCTGAGAGAAAGTGTCAGACCTGATCAAGGGTTTATTATCGACCAAGATCATCAACCACTCGACGTCCCCAT
GGGCGTCACCGATCGTGatcatcatcaagaagaacggtgTGGATATACGATTATGTATTGACTATCGATTGGTTAACGGTCTAACTCGGCTGACGATCTA
CCCGATGCCACTGATCAACGATCTGCTCGAGGATCTGGACAAGGTATTGTGGTACTGCTCTCTCGATATGGCGAGCGGGTTTTGGGTGGTGCCGATGACC
GATCGAGCTCGTGCGATCTCGGCGTTCATTACTCCGTTCGACCTGTTCGAGTGGAATCGAATGCCATTCGGCCTCAAGAACGCACCCCAGATCTACCAAC
GGCTCCTGGATAACGCACTGTACGGATTTATGCGGATCCCGCGATCAGAGAATTATAAAGGCATAGTGGATCTGTTTGAGGATGGAGAACCGGAGGATCC
AGGACGCCCATCGGTGCTAGGACGCAGATCctacatcgacgacatcctAGTGACAGCCGGATCCTGGGATCAGCTATGCAATCGGGTGGAAGATCTACTG
GAAGCGTGCGATAAGTGGAACCTGTCGATCAGCGTGGAAAAGAGCTTCTGGGGGTTACGCAAGGTGGACTATCTAGGACATCGGGTGTCGAGTGGAGGTC
TAGAGGCTAACCCCAAGGATCTGTCGGCATTAACGGATCTGCCTTTCCCTGGATCACTCAGATCGATGCAGTCTTTTCTGGGCAGCTTAAATTATTACGG
CCGCTTCATAGAAGACCACGCGATCTACGCGGCGATCCTATACGAGTTGCGAGAAGTGGACTTCGCCGAGCTGAGAACACGTCCTGATCTGCGTCAGATT
TTGGGGAAACTAGATCAAGTGCCACCCAATCCAGCATCGTCAGGACTGGGGGCGCTGGATCCAGATCAGCCAGACATCGACGTCGCGGACGAACGATGGT
TCCGAGCCCACAAGTCTTTCAcagcgttgaagaagaaggtggcgactGCGTCATTTCGATCCAGATCGACTACCAGTGGTGATCGTGTATGCCAGTGACT
GGGCGATCTCGGTTGCCCTGATGCAAGAACACGATCGGATCTACTGTCCTGTCACCTTCGCCAGTCGGACGCGCAAATCAAACGAGTTGAACTAAaatgt
ggtggagaaggaagtgctAGCGTTGCTGCGGGTCCTAGATCTCAACTACAATACGTTAGTGGGGCGCCAGATCCGGATCCTTACTCGGCACTCAACGCTG
GCCTGGCTATTCAGATCACCCGGCCTCCAGGGCCGACTAGGTCAGTGGGCAGCTCTCCTGGCACCTTGGACCCTCGAGATCGTGAAGTGCACGAAAGGAG
AAGACGAGATCTTGGGGGCGATTGCCGCCAGTATTACGCCTAGATCCAAGGTAGACGAGGCTTTGGTCGCGATCGCACCGAGGAAGGAGCTTCGACGTCA
GATCCAGGTGCCGATCCCGACAGTGAAGGCCGATGAAGGTCTGTTGGTGGTGAGCTTCGATGAATCCGCCCGCGCCAAGCGGGCAGGAGACGCGTTCGGA
GCGATCCTATGGAAATTACCTGAGTGAAGTGTGGTGAAGTCCAGATCTAGCTATGTCGAAGGTCTTACAGTCAATGAAGCGGTGTATCATGGCTTACTGC
TATGATTCGAACGGTTGGAAAACTTGGATTCGGGCGCCTAGTGATCTGTGGCGACTCTAACATAGTGATTCGGCAAGTGAGAGGAGAGATCGACTGCCAG
GCACCCTGGCTAACGTTATTAAAGCAGAAGGCTCTAGATCTACTGCGGATCTGGCCAGATCACGAGCTACTACATGTTAAACGTGACTGGAAAGGTAGCG
CGGATAGCCTGGCGAGCGCAGCTCTCCAACGTCAGGGAGGGCTTGACGTTGAGAGTGAAGCAGATCGTCAAGACCTGATCACGTTGAATCGACTTGACGA
AATTCTGGTAGTCGGATCCAATGATCCAGTCGCCCGGATCTCGCCAGTGGCTACTCAGTCCGGTGCTCGATCTAGATCAAACCCAACGGTCATGCAAGAA
GAGTTTGTCCGTGGGCTGCGGATCGATCGGATCCGAAAGGCACAAGATGAGGAGGCGTGGATCTCGAGTATGAAGAAGTACTTGGCAGGATATGTGGTGA
ATCTGATGCAAGACGAAGCTAGACCTCTCGGCAATATTGCGGGTGACTATGAGGTGGATAGCCATGATCTGTTGTTCTACTGCCCGCCTATCAAGAGATC
TGAAGCCGATCGCGACAGATTGATGAGGCTGGTTGCACCAAAGGCGCTACACCAAGCCATCTTGCACCATTTACCACACAAGTCTGGAAGGGTGTCATCA
AGGGATCGGCGTATCTATCAGCGGATCCGGGATCACTTTCGCTGGAGGGGTCTATATGATAGCGTGCAGAAGTATGTCGGCAGGTGTGTTGACTGTGAAA
CTGGCAAGGGACGATCAACAATCAGGGGCGAATCGCCTGGAAACATCCAAGCTACGTACCCGTTCCAAATCATCGCGATGGATCACATATCGTCACTACC
CAAGTCGTACAAAGAcaacacggagctgctgatctgggTCGATCTGTTCACGGGGTACGTGGTCGCCAAAGCTAGCGCGTCCCGGACGGCGCAAACGATC
GCCGAATCCTATGAAGAGTGTGTTTTCCGGAGATTTGGAGCAATTGAGGCAATTTGACACGATCGGGAACCCAGATTCATGTCGGACTTCTTCCGCGCGT
TTAACAAGATCATTGGACAGCGTCAGCGGGCCACGATGGCCTATCGACCTCAGGCGAACGGCACCGCAGAACGAATGAtacagacgacgacgagagcttT
GAAGATGCTCATTCAGGATCTAGATCAACGAGATTGGGATGAGTATGCGGAGTGACTGACGTTCGCGATCAACACGACTCAAGATCGGGTTCGTGGAGAT
ACACCCTTCTATCTGGTGCACGGATGGGGTCCGCGATCGACACTCGAGGCGACTATACCACTGGGGTGCACCCGAACACAGGATCGCGATCCCCGGAGGT
GGCGATATCGGATCCAGCGACATTTCACGCAAGCCCGAGAACAGGTTAATGACCGACTGCGAGACGCGATCTCGGATTGAGCCCATCGGCACAACGAAGG
AGTTCGACCGCACTCGATCGGAGCTGGATCTCAAGTGCGGCAATATCTGGATCGAGTGAAGGAAGGTTGCGCCCGGAAGTTTGCCCATCTGTGGCATGGC
CCTTTTCGCGTTGCGGAAAAGATCAACGAGTACACCATGCGACTTCAGACCGATGGGACCGAATATCCTCTATTCCCGGTTGTTCATGTGTCGAAGTTAA
AGCCGGTTAGGGAATTCCCGGGTCGACCGCAGATCGAATTGACCGTAAACGAAGCCGATCGGTTAGATTTCGACGAGATCTTGCTTCCCGAGGATAGCTG
GGTCCCAGATCTGGGTGCGAATGaatacgaagtggagaagatcgccgacATGAGGACTGGTAAACGGACGCGGTACGGTCGAACCTATCGAGATTTCCTA
GTGCATTGGAAGGGCTACGACGATCCCAGCTGGGTAGACGAAGCTGACCTCAACTGTGGAGCGCTGCTACACGAGTACCTTCGAGATCGTGAGAGTCGAA
ATCGGTTTGGCGCGATGGAATCTCACGAGGAGGAGTGAGATCGGACCACCAAGGTGAGATGGTCACCTTGGTGAGGGAGTTGGATGATGGATCTACGGGG
AGGCTTAGATCGGAGGAAGGGTTAGA