Description :
From Genome Similarity Track
Location :
Scaffold_72:14748- 15784
Transcript NameFunction/comments
g13582.t1RAW38228.1 hypothetical protein PC110_g5520 [Phytophthora cactorum

Sequence
1036 bases(100 bases per row)
GTAGTGCTGCTGCCTGGAACGGGTGAACATGGGTTCTTGCATCGGAGGTCGTCTATTGCGATCCCTCTGGCGAAGCAGGGAGTTGCGACGTTGGTACGCC
AAGATATGGATTTGATGACTTGCTTGAACTAGTCCTGGTGCTTACGTGTGCATTCGTGCTCTTGTATTTAGATCTTGGAAGGACCTTTTTACGGGAAGCG
CAAGCCACCTCAGCAAAAAGGATCCAAGCTGCGAAGGTACAGCAGTACCTGAGTGTGTCTGTAATTCGGAACGTCCGTTTGATGTTCCTATTCATGCTGT
GTTTGCAGGGTAAGCGATCTGCCGATCCTAGGGCAAGCTACTATCGAGGAGGCCAAGTCACTGCTGGAACACTTCCGTGATTGCCATGGGTTCTCGCAAC
TGGTGGTGGCAGGTAGCAGCATGGGCGGACTTCATGCTGCGATGGTGGCGTCAGTGTTTCCTGGAGACGTTGGAGCGACGGCATGGCTGGCCCCACCGTC
AGCTGCTCCCGTATTTGCCGACGGACTGCTCTCAGGTTCCTGTAACTGGCGCTCACTTTACAAAAAGCACGAGTTGCAGATGCTGGACAAAATGCTAATT
GGGCATGCAGCTGCCGAGTCCTACGAAAAGCTGGCAAACACTGCAGCCGATGCCCAGGAAGAGGGAGCGGAGGCTACCGGTAACGAGGACGAGCTAGATC
CAGTTGACGAGGCCAAGAAACGTATGAGACTGTTCCTCTCGATCACAGATATCGACAATTTTCTGCCGCCTCGACGCTCGGATGCCGTTGTGTTTGTCTA
CGGCACCGAAGACGAGTACATTGGCTTCACTGAACCACAGTGGGCGGTACGTTGTGCCAAGCCATCGATCAATGCTGCTGTATGAAGCATCTAACTTCCT
AACTGGTGCCTGTGCTTGTCTTTCAGCGCATGCGCGAACAATGGAAGCCGGCGCACTTCAGAACTATCAAGACGGGCCACGTCAGCGGGATTTTACTGGA
GCAGGAAGCCTACCGCAAAACAATTTTGGAGGTTGT