Description :
From Genome Similarity Track
Location :
Scaffold_166:14746- 19833
Sequence
5087 bases(100 bases per row)
CCCACACAGGGATTACGCACAGACTTACTTTGATGCCATTTTTGTCCATAGTCGTGCCGAACAAGGTCGGTCAGATGTTGGAAATCACATCAGTCATTTA
CGAGCCGTGCTCGAATGCGTGCGCACTAATAAATTGTACGCCAACGCGTCTAAATGCATTTTTGGTGCAGAAAAGATTCCTTTTCTCGACTCTTTCATTG
GTAAGCGCAGCCTCAGAGCGGATCCCACTAAGGTCAAAGATTTAGTGGACTGGCCGATTCCTAAGAATCGAAAGAACTTGCGTAAGTGGCTTGGACTTGC
TTACACAGATATAGTGAAACTTACGCTGATATGGCTCGGTCATTAGCTGATCTCCTTAAGAAGGACATCGATTGGCGCTAGGACAACACTCACGCTAACG
CATATCGGTCAATCAAGGAGAGTCCCCTCCATGCTCCCATCTTGGCGTTGCCAAATCCAGAGTACACTTTCAGTGTTGTCTGCGACATTCGACTTTGCCA
TAGGCAGCGCTCTGTTACAAACAGATGATGCCGGCCGCGAGCGAGTTATCGCATTTAAATCACGTCAGCTCAAAGCTGCTGAAAAGCACTATACAGTTCA
TGACAAAGAGCTACTTACTATGAAGTATGCGCTCGTTAAATTCAGAGTCCATATGCTTGGATTCAAGTCATTCGTTGTCTATACGGATCATGCTTCATTA
CACACGGCGACACAGTCACCTCACCTCTCTCATAGAATGGCTCGGTGGCTTTCCTTCTTTGCGGAATATAACGTTGAGGTGAAGTACTAGCCAGGCGAAC
AAAATGTGTTGGCAGATGCCCTCTCTCGCCGTCCCGATTACGATCTTGCTCATGTCAATACTTTGTTGTCTCCTATTGAGGAGTTAATTCGTATGGCATA
TCCACGGTATTTTTAATGCGTGGCATTGCTTGATGTCCTTCGGAGTGAGGAATACAAAGACTCGGATAGTCCGTTGTCGACACGGTTGCGTGCCAGCCTC
CATAGATATTCCATCGATAATGGTCCCTTGTGCTATGGCATAGATGTTACGGATACCGCTCGTATTGTTGTACCTCACGATGAGGATCTAAAAATATCGA
ATCCCCTTTGGGGCACGTGACACTGCTCTCAGTCTGAATTAGTGACGGGAGATGACTTATGGCTATGTGAGTCAATACGAATGGTGGCCCAAACTCTACA
AATGGGTGAGCACAAATACGTTCGTACATGCGAAACGTTCCAGCAGGTCAAACACTCGGCACACTCGGCTGCACCGCTCACTAGTTTGCCTGTGCCCACG
GATTGTTGGGATTCCATCAGCATGGATTTAGTGTCCGGTCTCCCCAAAGACAGTGACAGCAGTACAAGAATTGTGCTCTTTGTTGACCGTTTATGCATGA
TGGCTCACCTAGCGGCAGTGACGGACTCCATCGATGGTAAAGGTACATCTACGCTGTTTATCGATCGTGTGTTTCGTCAACACGAGTTGCCTCTGGCAAT
CATCTCCGATCTCGACCCTCGCTTTACGGAAACGTTTTGGACTCCCAACTTCAAGGTACTTGGCACGCGATTGGACATGTCTACAGCGGATCATCCGCAG
ACCGATGGTCAAACTGAGCAATTTAATCGCGCCATCGGCGATATTCTTCGCAGTGTTTGTTCTGAGTCTCCACGGACACGGAGCTCGATGCTCCCTGTCA
TTGAATTTGCGTTGAACAATGTTGTTCATGCCTCGACCGGCTTTACTCCCTTCTACGTAAATTTCCTCACGCACCCCCGCGTTCCGCTCACGTTACCACT
ACGTGGTTCTGGGCTTGGTGGGGGAAATTCTGCTGACAAGCTTGATTAAATCATCCCTACCACGATGCAGAAACAATGAGCGAGTTTCTCTCGACACGCT
TTAGTGTCTTACGACGCGTGCGTGGTGCAATGGCTGATAGCCAGGACAAACAAAAAGAACAAGCTGATGCTAAGGGCAGAGGATGTATTGATTATTATGA
TGTCGGAGACCAAGTCTTACTAAATGCTAAAAAATCCACCTACAAATGTAGTGTCTGCCGTCTTCAAGAAAAAGTTGCGCCCACTCTTCATCGGGCCGTT
CGCAATCATAGCGAAGAAGGGCATTGCCTATACACTCAATCTTCCGCGCAAGTTGCGCACACACCCAGTGTTTTACATTGGCTTGCTGAAGCCATATCAT
GATTCTCTCTCGTGAACCGGATGACGCTTGTGCCTGAAGGAGGGACGTCGTCCCTGATGACTGCATCTTCTTCAAGAGATCCACCTGTCTATCCAGTCGA
GGTAGGTTGTACTTCACCTTCCGCAATCGTTTGTCGACTGGGTCGATCGAGCCGAGACGGTTCATCTGCTCACGCAACTGATCCAGCTCAGTTGATGACT
GTTCATGAGCGCGCTGCACTTGGTCGAGGAACTCCCGGAGTTGTTTTCTCTCATCCACAGACTGATCCTATGCAGTCTGCACGTGAGCGAAAGACTCGCG
AAGGCACGTCACCTATGACACTAGATCTCTATGAGCCTGTACCGACACACCGATCCCCTCCTGCGTTGTTCGACGAGCAAGGGAACTTGCAGCTCCGTGT
GGAGAGGCTTCTGAAGCGGCTTCGTCCCAAAGTTCCATACCAGTCTCTGGTGAAGTGGTATACATACCCTTAGTCTGAGAACTCATGGGAGTTTGAGGTA
CCTGTTCGGAAAGATTGCCCGTACGTCGTTGACGTTTTTGTTTTTTTTGCGCTGATGGTCAGCTTGCATCTTAACGCACTTCTCACCAATAGGTGTGGGG
GTGTACGGCTCGCTCGACAATACCGAGTGACCCACGACTGTCTGCACAGTCGAAACAGTGGAGGTTTGGCCAGCAACTGTTTTGTCATAATGAGTGCGAT
ACAGTGAACGTAGTTGGCATTTGGCCTTCAGCGTAGCAAACTCATAACGCAATTTGCGCTTTAACCGAACGTTGTCCTTGAAGGCACTAGCTCTAAGGGC
ATTCATCATGGGCAAGCGACGTGCCCTATGGCCCAGTGAGTAAACGTATTGTCATCTTCGGCCCTACTCTCGCCGGGGTCCAAAACGACCGGTATCGTTC
TCTGCGTCGGTACAGAGGCACCACGCGCTTGTTCCGTTAACTTGATTTGGTAGTCCGATATGGTCGCCGTTCCGGGCGCTAAGTATCTCGATCTGAGAAC
ATCTCGTTTGGAAACTTCGTTAGACGCCGTAACTTTGCGCCATGTGGGCTAAGTGTTTAAGGATGCCCTGCAAACTTTTGCAACAACTCATCAACGCTTA
AAGGCCTAAATCGCTAGTTCGTATGCGCCTCGGTAATGGATAATGTATTAAATAGACGTCTAGCTCTCTCGTTTTCCTCGATATAGCGTTGCTGTTGCTT
ATCGAGATCGTTGGTGATGATAGGCTCATCAAGAGTGGTTGAGGCACGCAATGATGTTAGCGGTTTAGCCGTGCTTCGTTCCGGGAATGGGTTTGGCGCT
ATGCGAGAAGGCTCGCACGACGCTGACGTGGCAGGTTCGGGGGTTTCACCCTCTTCCACGACAGTTTCACTGTCATAATCAACGATGTTCCCTTCTCGTA
TGATGTCTTCCAAAGACTCGGAGGAGAGCAAAGACTTCGCCGTTGATGCGCAAGGTATCGTGAACAAAACCGTGAGGTTATCTGTTCTCTCCGAGCTGTC
TCAATGAGAAAGGTGAAGAATGTCGATTCGAGGTATCGACTGTTTGGTGGGGGAGGGTGTAACGGGGTTGCACAAACATTGTGATAATCAGGTACGCTGG
TGTGATATGCACATAAAAAGATCAGTTTTACTGATAGGCGTACTATTATTGTATCACATACGCTAAGAGGTAATGCCGTACTCTTATCGGTTACGGATAG
ATGGTATCTACCGAAATAGGGTCTTCAAAGGAAGGCGTAGTTCTGGTGGGGTACACAAGAAGTACTACGATGAGGACTATTCGATTAGGTAACATAGGTT
CAAGGTTAAATACGTAAGTGAGGTTTATTAACGCTATAAATCAGTAAATACTTTCAGTTTCCCCTTTTGATAAATTTCAGACACGTGTCTTTCTAAGATG
TATCTGGTTGTAAGCGTTAAGCGTATGAGTTAAGGCTAAGTACTCTTGGACATTAGTGCCACGTGATTCCTTGGAGTCGTAGTCCCCTGAACCAGGACTA
GAATCTTGCGAGCTTGTACATACACTTAGAGTTAATTATCACTGAGTCTGCAAGACTTGAGACCCTTTAAGTTAATACCCGCTTAGTTTGATATACTAAG
AGACTCTACGAGTCTAGAAGTCTTCCTCTGACTAAGGCGTTAGGGTAGCTCCGCTACACAAGACGTCTGGAATATCCTAAGCCAGGTTAGCAACGCTGGA
GTCGAGTGACCCGGTGGTTGTACAAGGCTCACCGCGGTAGGAAATGCTCTTGATGGTGGAAAAAATTATAGCTCAATGCATTGCATGAGACGAATACCGT
CAACCTGTTTGTGTATTTGTCCGCGCTCTCGCGTTGCCAACGCTTGCACTTGACGAAGACTTTGCAGTTTAAATTCCTGAACCCATTACTCCAACGTCAC
CGCTTTGTGCTCATGTACAACCCTGTTGCGCTAGACCCAGAGAGTCGTTATACATATTGAACATTGAGCACAGGACGCACCAAATTCGCCTCCACTGTGC
AACATATGCCGCTATGGTGTCTCCGAACGCGCTCTGTAGCCGCCTAGAAATTAGCTGGGACAGCGGCGGGGGTCTCCGCGCCATACCGAACACCTCGTAG
TGCTGTAGACGGTCATGAGATCCGACCCGACCTGTCCAATATGTCAAGATCTCCTGCAACACCCTTGCGCTGCTGGGCACTCCCAAATAAAGTGATTGAG
AGTCTCGTTCGTTCCGCCACAGATTGGTAATTTTCGACAGCAATTATTTCGTTACCGTCCAGGAAAATATAAATTCAGCTGGTGGAGCACCATACGACTA
TTATCCACACTTGGTAGTCGGTTATTGCGTTGCGGTGACTCCACAAAGCTGTATGTGTCTGCTGAAGTGCCGCAAAATGCCTTGGAC