Description :
From Genome Similarity Track
Location :
Scaffold_46:147431- 149739
Sequence
2308 bases(100 bases per row)
TTACCTCCCGATAGAGGCGTACGTCATGAAATTGACTTGGTCTCTGGAACCAAATACTGCGTCACACGGCAGTAGCCTTTATCAAAATAATAATGTGACG
TCGTTGACGAGTTTTTTTTAGTGCTAAGCACGTGGCGGGAATGGTGCGCGAGAGCAAGTCATCTCATTCCACACCTACCTTTTGTGTTAAAAAGCCTAAT
GGTAAGTGGCGTATTGTGCATGCATATGATAAGCTTAATGCGGCCACTATACCGGCACACACACCAATTCCTAAAAAGGATGTTCTTCAGAAAAACATGG
CAGGGGTACAGTCCACTCGACCCGGTCGATAAGTATTATCAACTCCTCATACGAGCAGGTGATATCCCGCTCACAGTACTTAAAACACCAAGCGGTATGC
TTGGGATTGGCTGGTTATTCCCCAGGGGCTTTCCAATGCCCCGGCTACGTTAAATCGTCTAGTGACGCAACTTTTCCGCCCTCACCATGCTTCTGCATAA
ACGTATTTGGATGATATATTTGTTCATAGCCGTGCAGAACAGGGTCGGTCAGACGTGGATGACCCATCGATCACGTACGAGATGTGCTTGAGTGCATGCG
CACAAATAAGCTGTACGCTAATTTGTCAAAATGCATCTTTGGTGTGGACGAGATTCCATTTTTGGGGTGTTTCATTGGGAAGCGAGTCCTTCGAGCGGAT
CCCGCAAAGGTGGAGACAAAAGTGAATTGGCCAGTCCTAAGAACTAAAAGGATCTGCGCAAGTGGATTGGCCTTGCCAATTACTTACATAAGTATAGCGA
CAATTACGCTGATATGGCTTGGCCATTGTCCAGTCTCCTTAAAAAGGATGTATGTGGTGCTGGACTAACACCGAAGATGAGGCCTTTAGATCTGTAAAGG
AGGGTCTCCTACATGCCCAAATTTTAACTTTGCCAGATCCTGATCTACCCTTCAGTGCCGTCTGTGACCATTTGATTTTTCCATTGGATGACCTCTGTTA
CAAACTTATGTTGAGGGACGCGAGCTTCCCATCGCTTTTACATCTCTCCAGCTTAAAGATGTCGAAAAGAACTATCCAGTATATGACAAGGGTATACTTG
CTATGAAATATGCTCCAGTCAAATCCAGAGTTCATCTGCTTGGCTTTAAGCCTTTCGTGATCTATACCAATCATGCGTCTTTACGCACTGCGAACCAAAC
GCCTCACCTCTCGCAGACGATGGTCCGTTGGCTTTCATTCTTTGCAGAATATAACTTCGAGGTAAATTATAAACCTGGAAAGAAAAATACGCTGGCTGAT
GCGCTGTCACGCCGGCCTGATTATAATCTCGCTCATGTTGCGATTCTGTCCTCATCAGTTACTGACTTGATCCGTGCGTCCTATGCCAAGGATGAACAAT
GTGTATCTTTGCTACGAGATCTTGGAAGTGATGAGTTTAAGGACTCGGACATTAAATTGTCGGCAAGTTCGCGTGCTAGGCTGCATCGATATTCTATCGA
TCACGGCTTGATGTGCTATTGCACGGATGCTGCGGATACCCCGCACATCGTTGTTTCTCATGGTGAAGAAGTGAACTAGTGAATTATCTATGAGGTCCAT
GACACAGTGATTAGCGGTCATCTCGGTCTTGAGAAGACCTATGGCTAAGTTAGCCAGAGTCATCGGTGGACCAAACTCTAGTAATGGGTAAGTACTTATG
TGCGCACATGTGATACGTCCTAACGGGTCGAATCCTTGGCACATGCGGCCACGCCGCTGGCTAGCTTGCCCGCACCTTCTAGGTGTTGGGAGTCCATCAG
CATAGACTTTGTATTTGGCCTACCAAAATATTCGGACGGCAACACACCTATTGTGTTTTTTGCGGACCGTTTGAGCAATATGGCTCACTTATTGGCTGAG
CTGGACTCCAGGTATGGTGAAGGGACATCTTTGCTGTTCATTGGACAACACGGTCTACCACTGGCAATTGGCTCGGACAGAGATCCTCGTTTCACGCCTA
GCACCGTGAAACGAGGCACCAGATTATACATGTCTATAGCGGATCATCCGCAGACCAATGGTCAGACTGAGCGCGTTAATTGCGTCTTCGAAGGTATTCT
ACGCAGTGTGAGCGCTGATACGCCTCGTTGTGGAAGCTCAGTGCTCTTCATTGTTGAGTTCACCATGAACAATGCCGTCCATGCCTCGACCGGCTATACT
CTGTTCTACGTGAATGGTCCCAACCCCCCGCGTTCCGTTGACGCTACCACTACGTCGTTCAGCACTTTGATGGGGGATAGGTGGCTGTTCGGCTTGATAA
AGACAGCC