Description :
From Genome Similarity Track
Location :
Scaffold_235:14742- 15891
Transcript NameFunction/comments
Phymu_g7272hypothetical protein

Sequence
1149 bases(100 bases per row)
AAGCGGTAGATTCGTTGTACAGCGTGGCATACAGCGCCGCGCGTAGGTCGTCCTTGCTTGAAAAATATGGCAATTCGAGCATATTATGGCACGCGTGGCT
TCGGAAGTAGCCTGCATCCTTCGCATCAATCAGTGTAAACTTGCACGGTTGTCCATCGTAGCTTGTGAGACCCTGGAAGCCCACAAGGGGGACTCGACGA
CAACCAGtggagaactgcagcaaccgcTTCTGGTATACACCCGACATTTCCTTGACAACGTCCCAGAACCACGTCACCTCTCGTCGCGGCTTCAGTGCCA
ATTTGGTATGAAGCTGCCAATCCGAGACATTGATCTCATCGGAGCCACACAGCAAGTagtccagctcctcgtagTCAAAAGGCAGTAGCATCCGCTGGGG
CACGACCTCATAGAAACCTTTAAGGAACGAGGCCAACTGCGGTGCCACGCACTCAAACATCATGAAGCGGAACTTGCGATCCGCGAACTCGAACTTGTTG
TCATCGTTCACTTGGATGTTTCTGCCAGTAGGAATGAGCTCGACGGTCTGAGAGTGGCTTTCATGGCGCTGCGTCACCGTGAAATCTAACTCGAGGGAGT
CTGCGCCGTCGTTATCAAGTAGCCACGTCAAATTCCGGTACATCTCTGCATCCAAACACGCCAGGTCTCCGAAAGTGATTGGAGTTCCCAGCATCATTTT
GAGCAACGGCGCACACAAATGAAAGTCGAGCACGGCTCCttcgagaagagctcgccCAATTAACCTTCCAGTTGCgtgaaaatgctgcagatGATCAGCT
CCTAGCACGCGCTTCGACTGCGGGTTAATGAAGTACGTCTGGTCGCTGCGCTGCGTGCAGGAGAAGAGTCCGACCTCCGgatccaccagcttctcgttca
gTAGAGTCAGCCACTCACGATGAAGCCCACCgacgtccttctcgtcagGAGAAAAGTCTCCTTCACCAGCGAAATTGACTTGGAGACGCACTGAACGGAT
ATTCCCCTCGCGGATGCAGTTGATGTGCTGAACCGACTGCTCCAAAACGTAGTCGCGGTGCACCGATAAGCAGGAGCGCAGAGGCTGTTCCCCGGCCTGA
AGTGCCGTTGCACTTGCAATGAAATGTGCGTACTTCGTGGGGAAATCCT