Description :
From Genome Similarity Track
Location :
scaffold_292:14741- 35293
Transcript NameFunction/comments
Pl_106491conserved hypothetical protein
Pl_106492hypothetical protein PHYSODRAFT_308450
Pl_106493hypothetical protein PHYSODRAFT_474852
Pl_106494hypothetical protein PITG_00933
Pl_106495hypothetical protein PHYSODRAFT_477229
Pl_106496conserved hypothetical protein
Pl_106497hypothetical protein PHYSODRAFT_538644
Pl_106498hypothetical protein PHYSODRAFT_320732
Pl_106499hypothetical protein PITG_00928
Pl_106500isoamyl acetate-hydrolyzing esterase, putative
Pl_106501phospholipase D, Pi-PLD-like-1

Sequence
20552 bases(100 bases per row)
ACGAAGAGACAGAAGATGACGAGAGCGTCAGCAATGGCGGAGAGAATACCGAAGCGCAGATTATCAACAATATGACGAATAAGAGGAAACTCCCTACTAT
GGCAATGCAGACGCAGGATACGGCAAGTGCAAGTTCTGAATTACAGGGATTCTATGAAGGAGGTCAACCAAGTCTCGTATCGGTATTACCGATGCAATAT
CCGTCCCCAAATTTGGGGAAATCTACAAGTAATCCCACGACGGATCTTGAGATTTTGAGTGGAATTGCCAATTCCTATACTCAGAATGTGGCAGCTGATG
GACAATTATGTGGCAATTGCAGAACTGTCGTGACGGATCAGCTGATGGAGTCCATTCGATTGGGCAAGACCAAGATGCAGTTACAGGAGTGGCACAAGAT
GACAGAGCAAAGGGATCGAGATACGCACCACTTGAAAGAGGTGCTGGGGATTTTACAGGATTTAAGGAGATCATATCGAGAGATTCAGCAGAGTGGCATG
GGTCATGAGTTGTTGGTGGAGTTGCAGGATGATATGGCTTTTTTTCAAACCTTGAAGGAACAGACCAAAGAGAGGATGAGGCAAGCCATGCGGGATCGCT
CGACCAACAAGTCCAACGCCACGGCGTAACTATCATCAACAGGCAAATCGATTTGTGTCTCGTTATCTACCTACGCATTGCGTTACAGACCTGATCATTG
GAAGGTATCTGTTGACCTGAAAACGTGACGCTATGGCTGTGATGGCGCACACTCATGACGAATTCGTTCGATGTGGAGCTTTGCTTGATTGAATGAAGCA
CGACGATATTTTATTCCTCAGTCAAGCAGTTAGCATGCGAGTTGCATCTGATAACAGCATCAACGTCAGCATGTGCAAGAATGTTGTGGTCGCACGCCCA
ATGCGCACTTGAAAGTCTAACTGCCCGTTGAAGTTGGACATGTCAACTACGTTGTCACTTCCAGCAAACTTTTAGCTCATTTGCGAATCTGCAATCTTCG
AGCACAGGCCAGATTCATCCTTTCAAGCCTAATATTCTCGAGTCATGAGTGCACACATCGAGGTGACAACTCCAACGTATAATCATGCTGCGTCACCGCC
ACACCGAGAAACGACGATGTTGGGACTACCTGGACATCCTCCGAGACTGTCCACGTTCTCGCATCTCGACCTCAACGACTCCGGCGAGAGCAAGCATGCA
ACTGGGTCCTCAGTGGCCATGCTCGTGCTTCTTTCCCTGCCGCGGATGACCACCAACATGGCATGGTCGGCACAATGGGCTGCACTTGGCCCGTACCTCG
GCACAATGCTGCCACGGTATGCAGTGCAGCTCACACAGTTGATCGGGCCGCTTTCTGGTATCCTTGTAGCGCCAACAATTGGTGTCTTGAGCGATCGTAG
CACATGCAAGTGGGGACGCCGCCGGCCGTTCTTGGTTTATGGAGCCGTAACAAGTGCTGCGTGCTGGACGCTGATGGGATACACACGAGAGTTGGGGGAG
CTGCTTGGTGACTCGGGGGATGATCGTCCGTGGACTGCATGGCTCACGATCTTATTTTACACGTGGATGGATATCACGGTGAATGTGGTGCAAACACCAG
CTCTTCTCATCATCGCAGACTTTGCAGGCGACCGTCAGACTCTAGGGGCCAGTATCGGACAAGCTAGCTCGACGCTCGGGTCCATCTGGGTGGCCGGGTA
TATCTACTTCTTCGGCGCTGCCCATCTAACGCTGCGTTGGTTCCTCGGCATGCTGTCGATGACCATGCTCGTTTCCGTCGGTGCTGTGTGCGTGTTTACC
AAAGAGGAAATACTGGTATCGAAGGACTTGGAGGTGAGACCTGGTGAGGAAGCTTCTAGTAGCATGAAGCGGATTGCCGAAGCTTTCAGCTGCATCTTCC
ATGGTCTGAAGTCGCTACCTTACTCGTTGGTAATTTTCAGCCTCGTGCTCTTCTGTGTCCAGTTTGGTTTTACGGCCTACAATGGCAACAAGGGTCAGTT
TTTTGGGATCGAAGTCTTTGGAGGGAACTCAACGGAGGCAGACGTGTGTGGTCCGATCCACTGTACGGAGGACCAAGAGCACTATAACGAAGGTGTACAG
ATTGCAGGTGGCATTGCGGACCTACTCTTCAACGTGTTTGGATACTTGTATTCGTGGGTGTTGCCAATCCTGGTCTATCGTCTCGGCGCACGCTGGGTGA
TCACGGTTGCTTGCATTCCACAAGCGTTGTTAATGGTCATGGCGTTCTCGAAAGTTGTTGCTGTGGACGTGCTGATTGTCGTCCTGACTGCTATCACGCA
AGCCACAATTTTTGCGCTCATCGTGCCTGTCATCGTGCACGTCTTTGGCATTTCTGCGCATATTGGCATGTATGTTGGTGCCGTGAACTCGGCGAATTGT
GTGGGCCAGTTGCTCAATTTCGTGGTTGGTGCAGCACTTGTGGAGACTTCGCTTGGGTATGCATTGCCAGTTTTTGTGGGGGGTGCACTCTCGTTCGTGG
GATCGCTGATTAGCTTTGGAGCACTACGGATTGACATGCGCTCTATGTAGTGGGAATCCTGTCACAACGACATGCTGACGAAGCTTTCACTTTCCTTAAT
CAATTAGCTTGTTTGGCCACTTCTTTTTTCCACACCTCAGTACATATTTCGACGACCCGTGTATCCCAACGTTGTTCCATGGCTGAGAGAGTTTGCAGAA
ACCAGGTTAGTTTAGCTTTCACATTGACGATCCTGCAGCACTCACTAATTCTCTGCTAAGAGCGTCTTGGATGCAGAATTTGTGTAGCTCTCTGATAGAT
GACGTTCTGGTGGTCTGCAAAGGCACAAACAGATACGGTGGTAAATACTTTGCTGCACTCGTGTTCATACTTACAAACTCACGGGCGAATTCCGCTGAGA
TCATCAGCTGTAACAAGCTTGCCAATACCAGCCAGGAGAGAGCGACGGGAGTCGATACGACGACCAGAAAGTGATCCGCTACTGCCACTTCCATTTAGCG
ATGGTGACACTTGCCTACCTTCCCACGGAGATGAAGGTGATTGCAAGCGTGCAGAGTTTTGGCGTGACTCACGACCTTGTTCGTACTATCAGAATTAAAC
AACAGGTAATAGTGTCAGCTGACATGTGCACGTGATACGTGTGTTTCAGTGATTGAGGCAAACAATTACCATCGGCTCCACGTGACGCTTGTGCTGCGAA
TTCTGTCGTGTGCCAAGCACAAAGTTGTCTTTCGGGGTAGCCTCCATCAAGGTTTGCGACTCATACGATCTACAGCACGTTGATAATGGTAATTACGAAG
GCATCAATACCGACGACTTCCACTTGGAACAACAGATATCTTCACTTACGTCTTCCAGTCGCTGCAGCTAACGTTATTACCAGGACCAACCTAGTGAAAG
CCGATCAGTGTACAATTCCATGGATAACTAACAATTGATAGGTATCACCTGGTACACAGAGCTTTGAAAAGGAATGCCTGGTACTTGCTCACCCGATGGG
TTTTGCTGAGGCTCAAACAACTTCTTTCCTGATGTCGAGTTTTCAGCCGCACGTGGCATTATGCCACCTTTCTCATCGTAAATCAAACTCTGGACAGAGC
ACATTACATTGAGAAGATAGCCACAAATTCAAAAACACTGGATAGATAAGCTCGTACATCTTTGACCCCAGATTGATCCGTGAAGTAGCGCTTCTTGTAC
GAACGACGGACGTAGCCTCCCCAATCTGCGTCGGGATGATCAGGGTCGTACTTGTCCGCCGCATGCGGGATCACAGGTGACGGTGTCTGGTTATTGGAAT
CGCGCGCGCCAGCATCAAAGTGAGCCATTTCAGCCTGTGTTTGAAGATAGCTTTTCTCCATGGTCTCTTTCCGCCTTTGATGCTACAACTAGGAAGTTTG
CTAGTATATTCACTCGATTCGAGCAGTTTCTTGAGTGACTCGTCGGCGACTAATTTCCTCGAGCTGTTCCGAAATGAGGTTCATGTGCTGTTGAACATCA
TTTGAAAACAGTTGAAACGACGTTCGCATCGATTTCATGACACTGCTCAGCGTCTCGACGCGTTGTATGACTGATGAGACTCGATCATTATAGTCCGTAC
GATTAAGCTTTGACATCCGTGTGCTGTTGGCCGGTATGCTGTCGTGATCCTGTTCTTTGGTAAGTCGATCTTCGTTTAGATTCCTAGCGCCTGCTACAGA
AGATCTGGCTTTCCATTGCATCGGAGGTAGTTTGTACATGTCCTGAATTGTTGTTGGTTCTGCATCTTCAACGCTGACTGATTTTGCTGCTTCTGGAGCC
TCCTCACGTTCACCACTTTTATCTACACTTCCGCTCTCGTTACTTTCGCTTTCATGGTTTTCAGAATTTGATGCTGTTTCAATTGCCTCAATCGAAGCTG
TCATCAGCAATCCAATGACTTGTAGACGGCCATCAGCTACACTTAACGAAATCGGATATCGAGCGCTATGATCTGGAGCTGTATCCGAAAGAGCCTTAGC
GACAAGATTCGAAAAATCAGTCGAGTTATGTAGAATAGTGGTGCATTTGACGGATCTAGCTCCAACCTGCAACCAATATTGGTTTACCATTAGCAATCAC
AACGAGTTGCAACCAACTCAAACGCACACGAACGGTTCTCACTCACCATAATTGCCGGGTAATCAAGTGAATCTTTCACTGATGGCCAAAGTATGCGATG
CCGTTTGGACAATCCGTCATCATCTTCTACCATCTTTAATTGCCAAATCCTCCAACGCATTTCTGAGATTATGCAAAACTCAAACCAAGAACCGTTCACT
GGGTTAGACCCAGTGAATTTCAGCGGTTCAGAAATACTTCGGACAGCATCATGCGTGCCTGAAGCTAAGCCTGGATACATCTAGTGAGGTGCAACATCCA
AGACAACACAGTTAGAAAGCAGTCTACATCTTACAGCACATACACGAGCAAACCTGGATCAGCTTCAGTTCGACAGTAGATCTTATTCCATCGTTTCTTT
GGATGAGTTTGAATACCTGGCATTTAGTTTCACAATTGTGAGGCATATCTACTCCTCACCTTCATAGAACCAACGTGGATACGTACGCTCAATGATCCAT
CTTGCTTACCCGCGAGGACAAACTGATTTTGCTGACCTCGAACGCCGCAGATCCACCACCGAATGCTTGTATACACGCAGTTCATTGTAGTCATTGCTAA
AGTATAAACAAGCCGGACATCCTCGAGTGGGTTGTCGCGCGCTATCACTCCAGATCGAGAGCATGGTCCAAGCTTCAGTCGTTTGCCTCCCATTTGTTGC
GACTTCGAAGGCACATTATCTTCCTTCTTTAAGAAACGTTCAAAATCAATCAGCGACAGCTGCCCTCCACCGTCTCCAACTACAATATACCGACCATCAG
GGCTGCACTCCGAGACGACCAATCTCTCCGCTTGCTGCTTCATCTGCGCCAGACAGATCAGACGATCACTAAAGCGCTCTTTCCACCTAAACACACCAAA
CATTGCAGAATCTTCAAACAGAACCACAACAGCTCCTGAATCTGGCGTCATGTCACTCCAAAAACTCTGCAAACAGCGAATACTCTGCACTGCAGCTCCC
ACAACTGGTTCCACGAAACTGAAGTAAACTTGAATAGATGCCGGAGCTTGACGAGGCTTATCACCATCCACAGCACCAGCATACTGAGAGACAGAACCCG
CATACAACCGGAACCCAAGCAGCAAAATAGTCCTGCTTGGATCTACTGTACTCCCTGTTCCCGACATTCGGGATTCCGGAACTTCCACGATAGCTCCGAC
AAGCAAAAAACCTGGAACGGGGCACGCCACACACGTAGCTGCTGCAACACATAGATCCTCGTCGCAAGTATCGCCTAAAACTGAACTGCGGAGGTGAGTT
ACGTGGTCTCGGATGGAGATTTGGCGAAGGAACGTGAAGGGATGTAAACTGTTGTCACTGACGCCGTACAAGTCGACGAAGCGGCCGTTCGCGATCGCAA
TCACGCCGGTCTGATAGCAGACAGCGATGCATTGATTGTCATTATTTTGGATCCGACACCCGATACGTGCAGCATCCTCCACAGACATGTCAACATCCAG
CACATGCAGCCGATCTTGCGGCATGACGCGTAACAAACCTGTAAGCAAACTGTGTACATAGTTTAGACCAATCGAGATCCACCCTCGGAGCTACGGCCGA
ACTTCCAAGACCAGGTTCCTCGCGAAGCTCGAGACATACAGGCTTTACAGAGAGATTCGTCCTGATGACGACATCTTATATGGGCTATATACCAAATGTT
GGCCGCCATCCGTTTGGCGCGGAAATGCGTCCTTATTAGCACAAACGAGTTCACGCATGCTAATATAGCGGAGCTAATAAGGAAGGTTCATGAAGGCGTG
CAAGCAGTGATCGAAGCATACAGAACAGCAGCTTACACGGAACACTACTTCGCGATTTACTAATCACAATTCATTCATTGCTGGAGTGTGCAAGTGTTTT
TCCTGAGTTTGTTTCATGTATGTGGAGGCTATGGCTATGTCGATGCCATGATGGCAGGTGGTAGCCACCTTTGGAGGGGAAAATCCTGCGTTACGCCGAG
GACAGTTTTGGATCGAGTATCGACCAGGCCATGTTAGTAGTCGTGAGGGCGAGTGGTATAACCTTTGGACCGAGAATTAGCGGCTTCGGTGAGTTCGTGA
TTCGGACGCTCACATGGCCTTAACATGCGGCTGGTGTCCGTTAGAAAACGCAGATGAACACGCTGATATTGGACGCGTTTAACAGGGCCGGTCTCCACAC
ATTAGGTCAACCAAGCCATTCACGGTACTGCTGCAGGCTCACGTTTCCGAGGCTGCAATCATCTTCATGGATATAACTCCCATCCCATGATTGAGCAACC
TCTTTATGGTCTTCATCCATGAAGTCCAAAAACTGTTCTCCTGACTCCCTCATCATTTCCTGCAATTTCAGTTCGTCCACGTGCAGATCCGCAAATTGGC
GGTTCAAAGGTCGTTCCACCCTGACATTTGGCTGGTGACTCTCACGACTACAAGCATGGACTGGTCGACACAACCACATACTGGAGCCTATCCTCGGCGC
AACGCAGTCATTTCTCCGCCAAATTAGCCACCCCTGTCATCGCAGCATCAACATCGCCATATCCTCGACATTTACGCGAATCGTAAATTTCGAGTGTCGA
TGACTATGTAAATGGCCGATGTTTTTGACCAATGAAAACAAAATCTCTCTCTCATTGGCCAAATTCACTTTTCTCCTCTAGATTTTTAATTGGCCAAAAT
AAAAAAAACTATGTTTTTCCGGTAGATACCGGTTTGATTAGATCAAGATAGATAAACCGGTAAATATCGGTATATGCTATTGTGCAGGGTAAAACCTACA
AACCCGGTAGCTTAATATGAAAACCGGTAGCTGCATTGGCCAATGAAAAGACCGTATTTTCACTGGCCACCAACGCCTTGCATCGCCTCCATATCTGGCA
GTGTCGATTTTGCCTCAGTGGACGAGAAGCTGGAGACATTAGATAGTGTGGTGGCCCACCTGATTTTATAGCGTGACGAGCGCAGGCGATGGAGTGAAGA
TAGCTAATTCGTTACTTCGTGAAAGGAGCGAGGACCGTTTTGGTCTCTCCTCCTTCTATGAGCATTACACTTTGTCATAGTTACACTGACCATCCGCCTT
TCAACCAGTTTGTACATTGCACGTGTAGTGGTAGCATAGAACTACTGAATTATGGTCAACTGATCGATGCTAGCCTGTACCAATCGTAGGGTGTAGATTG
CTGGTACATTCCATTAACGATTATCCCTTGGTTTTTTGCTTCGTTGTCCCCAAGGGCAGCACCAACTATCCATTAATGGATAGTTCTGTTGAGATTGCTA
GTTGATCTTACCTCGAAACATTCCTACGTCACTTGCATTACAGTAGCTATTGCTACATGAGCTAGACCACACCTGAGCCGTTACTTCGGCTGGAGAGGGT
CTGCCGCGAGGAAAACGTGCCAGATCGAATCAATGAAACCCTCTTGGCGAGCTGCCCTTGATGAATTCTCGGTAGCAAGCTGAAAAGGTTCCAACCCTCG
AGGATGCACGTGACGCCACTTGTTCCAGCCTCAGCACGCACAATGTGTACTCCTTGCATGTGACGGGTACACAAGTCGTAGAATTCCAGCAATGCATCCT
CCATGCTTTTCTCCGCGGCTTCTGCTACGTTGCTGACTGGTTGGTTCGGTTCATGAATGTGTGGTTCATGCTGGATATGGCTCCGTCGCGCTGTAATTTT
TGGTGTCTCGGACGATCTTGCTATAGGTGGGTTTTTACTTGCAGCCGCAGCTAAAGGTGCAAGAGTGAATTCTGTAGAAGACCCGGTGGCTCGTGAAGCT
GGATGGTGTCCCAATACCGGTCGAGTTCCAGACGTTGCGTAACTAGTGTCAGCAAACTCGGCACGCAGCGAATCTCCTTTAGCTTTCCACTCCTCAGCCA
GTCCACCAGGAGTGTCAAGGACATACTTGAGAACTTCGTACCATTCTCGTGAGAGTACACTATGAAACCATGGATTCTCTTGAAGTGCAGTTCCGAGATT
TGTGAATGCCCATGTTGAGCTTAGCTGGTATGAGTGTCGAAGCGCTTGAGCTATCCGATGAAGCGACTTGATCAGCACATACTGGTGGCTCTCGATGTTA
TGGTCATTACCTGCTTCGTGTTGTGGAGCTTCGTCTTGATTGTTGCACGGTCGAATAGACCCAGACGACCGTCTTTGGTTCGGCACCACGGACTTCTTTT
TCTTCTGCTCTAGCTCGGCTTTAATCTGCGCAATGTATTCTGCGTCTTCGCGCTCGTGGGCAAGCTTCGCGTCGAGACGATATGCAACTTGGGAGAAAAT
TTGAGCCCAAGCCTGTCGATTAAGTCGCAAGTCCATTTGAGTGCGGCAAGACCACTTTGTTCCAAGATTGAGACTCTTCATTACCAGTAAATCCTCCAGT
GTGTGACTGCACAGACACCGCAGAGAGAATCGCTGGAGGAGGTGATCAAACTGCATCGATGAAGGCAAACCGAGGTTTTGCATCACACGATATACATCCA
TTCCGCCTGTGAACAGGATCACCACGCGAATTACCACAGGTGGTGTCCCAGTAACTCCGCTGCTGGTTGGTCCCATGCGAAGCTGTTGTTTTGTCGGTAA
CGTGACAAACCATCGATGAAAGAACGGCAACGACTCGATATGATCACGGAAATATTCTCCAAGAAACCAAGTTAATCGGTCAACCAAGACGTGCGCATCG
CTTTCTGCCAAGGCACGACAAACGTGTTTACATTGTTCAAAGCACTGTCGCAACCAAAGTACAAACCTTTTGTGCCACTCCGACATGTTAGATCAATGTA
TAGGAAACACTCAGCCCCGCGTTCCAGATATTTCAGCTCGTGAAGTGTGGCGGCAGCTATAATACAACATGAGCCACGTTATTTTACCATTGTTTTGAAC
GCGGCGCATGGTTTGCTTACAATCGGCGTCCGAGTTGTATGTGAGATGAATTGTGGCAGTTGTAGAAAACTTAGGTCCAACATCAACTTTTAGCATGTAG
TCACCGCGGTCACGCTCAGGAATACGAGATTGTAGACAGCTCGCTGACAGCAGCCCCGTAGCTGATATTTGCGATGCAAGGACGAAAGCTGAACGAACTC
GTCGTTTGAGCCGCGCTAATGCGCAGAAGGACTGTAGTCGGCACTGCAAAAAGAAATTACGCCAGCGCTTCGCAGTAAACACGAAACAATTAGCAAGTCT
ACCCCGCAGAGAAACAAAGCCCTACTTACTGTCTTTACAGCTGGACACCACGATGAAAATACCAAACTAAGCAACCCAACCTTGCATATTCGAGACTGCT
CTTCATTGATTCCGCTCTTTGAACGCCCTTCATGCGTAAACCACAGTGCTGATTTTTGTCGGTATCCAAACAAGCGCAACGATCGCTTTAGCTGATGGAT
GAAGCGCTGACATCGTGCATGTTGGTATCTCCTCTCGATGATTTCCGTTGTCTCCTCACTCGTCAGTGCAAATCCAATCTCCGCCAGCAAGTATTGCGCA
GCTTTAGAAGTGACAGTACCCGTAGGATCATCGACATATTCATCGAATAGCTGCTTAATCATTTCCGTTCTTTCCAGCATTTCCCATTCCAGCGAAATCC
CCAACAGCACCAAGTCTCTTGCAAGCGGTTGTTCGTCCTCAATCAGCTCTCGGAACATCTTAAACCCCTCGAATGTAAGTCTTCCTTCTTCATCCAGCTC
ACAGATATCACTCATATACATTCTCCATATCTCTTCATTATCTTGAAAAGCTTTCATCTCAACTGAATCCTTCGAACACTTCAATGCCGCCATGTACTCG
AGAAACTCCTCGTATGTCCACATCTCGTCCTTGTCCTCGTCGAAAAGACTCCAAATTCGTCGACACTTGGCTTCACCCAGTGATGACAATCTCCATTGAT
AGCGAACTGTATCCGGAGCATCAAAATCGAAGCGATGCGCTGCAGATCGAGCCAACATCGCGTCGGATATCTGTCGAGTGAATAACGGACTGGATGGAAG
ACTTTTCCAAGGGGCAGTGGGCGATTCCAGCAAGTACGCGCTACCAAATCCATCCGTAACAGCTCCAGTTTCTCTCAAAGTGTTCTCTACAGCTCTCAAA
CTCGTTCGAATCTCCTGACGTCGCTCCAGAATCGCCGCTTCATTAGCAGCGTCCATTGTATCACAAATGTAGCCATCTTTGTTGAAGCGCTTCGATCTTT
CCGATACGTCAGCATTTGATTCGCTCGATTTGTTGACCAATCAAATGAAGCAAAACCGTCCTTTTCAACCAATCATATATCAAGATTGCTGTGGCTTCAA
TAAAAAGGGGAGAATTTGATTTAGTTCGTGAAAAATGGACGAGGCCAGCAAGGCGACGCTGTTCAACGCGTTGACGTGGGTAGACGCACTCAAGACGCGC
GACGGCGTGAATACCCAAGAAGTTGACGCTGCTCTCACCCGTCTCACGTAATTCCCACGCTCTAATTCGCAGTCGAAGCCACAAAAACTCGAATTTTTCA
CAACATATTTTTTATTTTATCTTAGCGAGGCATTCGGCGTGGACGTACACGACACAGAGCAGAAGCGACAGCTGGCAATTAATGGCGAGGCCTCGTTCGA
CGAGATTTTCGCTGCTGGACTGAAGGCTTTGAACCTGGAGACGGGTACAACGGAGAAATCTGTGGTAGACGAAGATCCTGTCGTCAAGAAGCGTGCGTGT
GGATATTCGAGTATCTAGAGGGAGGATCTGAATGGCTAATTAATGTTGTTACTGGTGCAGACCCTGAGCTGTGGAAGAAGTGGGTGGCCAAGCTGGAGAG
CAAGGGATTCTTCAAGGATGCGACTCCTGGCACAAGTGAATATGCCACACGCACGAACAAGGCATTGACCAAATTTAAGGAGAAATTTGGAGATGTAAAG
CCGGAACTGCCCAAGGAAGAGAAGGAAGCTAAAGCTGAGGAAGTGAAGGCACAGGGAAATGCAGCATTGAGTCGCCAGGACTATGAGGGAGCTGCCAAAT
TGTATCGTGAGGCGCTCAAGCTGTCGACGGATGGTCCATCATCTCATATTTACCACTCGAATTTGGCAGCGGCGTTGATGTATTTGGGCAAGTACACGGA
GGTGATCGACCACTGTGAACAGTCGATTGCTCTGAAGCCGTCGTACGTGAAGGCGTACTCGCGTATGGGTAGCGCACAGGTGCAGTTGAAGGACTTTGAC
GGTGCTATTGACACGTACCGACGTGGACTCGAGGTGGACAGCACAAACGCTGCTTGCCGCGATGGACTTGCAGATGCTGAACGCAAGCGCCGTCAGATGC
AGACGACACCTGCGGCTTCAGGCTCGACGCCTTCAGCTCCTGCTGGAGGCATGCCGGATTTGTCCAACCTTGCTAGCATGCTTGGTGGTGGTGGTGGCGG
CGGCCTTGCTGATCTGATGAACAACCCGCAGATGATGCAGATGGCCCAGAACATGATGCAGAATCCGCAAATGATGCAGATGGCACAGAATATGATGCAG
AACCCTGACATGCTGAACAACCTCATGGGTGGCCTTGGTGGTGGTGCTCCTGGCGCAGGTGCTGGTGGCGCAGGTGCTGGCGGCGCAGGAAGTGGTATGC
CTGACATGAGCGGTCTCATGAACAGTCCCGAGCTCATTGCAGCGCGATCGGACCCGGACCTGGCGGACTTCTTCCGTGACGTGGATAGCGAAGGCCCATC
CGCCGCTATGCGTCACATGTCGAATCCCAAGGTGTCGCAGCTTATGCAAAGCGTGATGTCTCGGATGCAAGGTTAGACAGGAAAGCAGCAATAGCGAAAC
AGCCTTGCTATGAGACTAAATGCCAACTGGTGAGTGAGGCTGTTTTTATTTTGTGAGATATGGTCAAAAGCCTCAAGCAACTTGCAACAATACGCTATGT
GTCACGAGAGTTGTATGTTTAGTTGTTGATGAAGGTCTCGGTATCCTCGAGGAAAGCCAGGTACTCGCGTTGCTCCTTGAGGTCAGCGAACTGCGTGATG
AACTGTGCCAGCTCGTCGTCAATCTTGCGCTCAGCCAAGTAATTGTAGAACTTGTCCTGCACGTCGAGCTCCAGGTCAATGAAGTTGGGGCCGAAGTACA
ACGTCTCGTCTTCTGCGTCCTTCTCAAAGTCACTCAGGTAGCGCACGCGCTCCACCGTGAGGTTGCTGCTGGCCACGCAGTCGAACTGCAGGCCCTTGTT
GTCACGGGTCACGTCAGCCGTGAAGCGGACGCCGGGGAGTTCGTCTTCATCCTCGTCGTCCTCATCATAGGCTTCCTCCTGCTCCTGCTCTTCCTCATCA
ACGTCGTCGTAGTCCTCCTCGTCCTCGAGCTCGACGGTGTCCTGAGCATTGAACTTGATCTTGATCGAGTCGTCGCCTACAGTGCCCTGCAGCAGGATCT
CCATGCAGCCAGGGGCCTCCTGCACCTTAAAGACCTTCTCCACTTGGGTTCGCAGGTCTTCCAGCTCCTGTTCCTCGAAGCAATTGGCCTTCTCCTCCTT
GATCTCGCGCTAATTCGTGAAATAATAGATTTTTACAGAATAATTAGATTGCGATTCAAGTTTTTCGTAGTTTTAGGAAATTCCAACGCGTACGTTGAGG
ATGGAGGCGAAAGAAGTCTTTTCACGGGTCTGCAATGCACGCAACGCCACGGAAGGCGTGCGGCGGGCGGCGGTGATCGTGGCGACGCGAGCAACTCGGG
CGAACATGGTCAGCTTCGGAAGATTCGAGTGTGAACGATAGCCACATACACAACGCCGTGTGATTGGTTAGAATAAGTGTTATTCCGTTCTCCTATTCGT
CAAAATGATTCCACAGATGTCATTTTCTAGAATTTCTAGATAAAAGATTATTGGCGATGATGATAGGACTGTAGTCTCGAGTTCCGTGAGGAAATCGCTG
TTACATTTACTAAGCGGTTGCTTTCAACGGGTGAACAGCAAAGCTCCACTGTCACGTGTAAAGATCGCTATTCTAGGGAATAACAACAGTAAATCTCCCA
TCGAAAAGGCTGAAGAGGCTATTGCGAGAGTTCTACGCATATGCGCTCTAGATCATGGGAGAAACATTTCAGTTTACTGGAAACGCTGTATCAGTAGAGA
ACGATGAGAGACAAGAGATAAAAGGCGAAGCTGAGCCATCCATTTGCATTTTGTTAGTGTTGAGCAGTGACTTTGTAGAGGAAAACACTGTCAAAGGCTT
GGTCGTCCTCGACAAGTTCATTCTTATCGATTGACTTGGCACTCAAACCCCATCGAGAGAGCAGAGGAGCGATCGATCGGTTAATACTTCGCAGTTGATA
TGTGAAGTAAAACTTGCATGTTGAAGTGCTGCAACGGAAGATGAGAGCAACGGTAGCAATCACCTTCTCGAAGTCTACACATGCAACGAAAAATGTGTTG
TTACAAGAGAATGAAATACGTGACGGGACTTGAGTAGGGTATACCTTCAGATTGGTAGAAGCAGTCAGCAGCGAGAATGACTTGCACCTTTTGGAAAATG
GAAATGATCTCATCCGAGACGTGTAGGTTGCCCCAAGTTAATGGGATGAACTCAGCACGACCTTCAAGTCCATTCAACTTGATATTAGCTTCTGCATTTC
GCTGAATGTCGACTGCATCGGCTCGATCTGTTAGATAAATCTTCGTAGCTCCACACAATCCCACGAGGATCGAGGGGAGTCCAGTACCACAACCCAATTC
CAGGACGACTTTGTCGCGACAAAGTTCCTCTGCTTCATGAGCAACGAACCGAGATAACAGAAGCGCTGAAGGCCACACAAACAGACCGTAATGTTTGTCA
TTATCTTTGTTGGCCTCGTCAAGGTCTCGAATGAACTCAGCAAGCCGCACTTGGACAGTGGAAGATTCAGCCACACGCTGTCGCTTCTGTTTCGGCTCTA
CTTCTCTTTCTTTATCATCTGAAAGCATAGTACTACCAGTACCAGACCCACAAACGAAACGGAACGTGCGTTGCGAAGCTGCATCAATGCTCGAAACCTC
CATGTTGCAGCACCAATCACGAAAATGGGACGAGAATTGATACTCAGCCCGTAAATTACGAACGAGATCACTTCAATTGGGAAAAGTATCTTGAAGCTGA
TGGCTTTCGACGCCAGTTCCGAATAACAAACTGACAACGATATGGATATGACTGACCAAGCTCTTGGCACGACAGTAATGTTGCCTGAGGAGGAACCCTC
GTTGTCGAAGCGGGTTATTATGGATTATTTCACTAGTGATGGACCTCGTTCTAGGAGACAAGACTCGGATGATTTTGAACAGGAACTAATGGACGAACCA
TGGATAATGGACGAGAAAAAACTGTCTGAGGTAGAGGAGCGAGTAAATTTACCTGAAGATGATAATTTGGAGAACTCAGGCTTCCCAGTGAGGAAAATAG
TGATATGGGAGACCGCATTTTCAGTACTTGTGGTGATTTTAGCGGTGATGTGGATGTGGAACGCGGTAGAACTAAGTGTACTGAGTTTGGAGTGCGAAGA
CTAGCAGTACTACATGGTTTCAACGTCGAAAGAAGCAATCTACGAAATGAATATACGTATTATCAAAGCTTAATGCACTACTTTGCAGGAGTGCAGCAAG
TCTCAATCTGATGCTGCAATCGTGCAACATGCTGGGTAGTGATGTCTCGCCCGCGAACTAGATCTATAAGACCGCGCGTTTCCTCGCGCAATACGTTGAG
TTGGCTACTGTCAAGAGACTCTAACGCTTCTTGAAACAAGGAATCTGAAGTAAGTGAATATTGGGTCTCCTGACCGTCACCGACTGGAGATGCTTGCTGC
ACTTCGTCTTCGTCGTCATCCCATGAATCTGTGTTTTCGACAGGCTTTACATGAGGAAGAGCAAGAACGTGCTGCCGTTCGCTATAAAGTTGGGTAATGG
CAATGACCACTTTGTCCGAGTTAAGGTGATCATTCTTGGTTGCTCGTAACCATAGTTGCAGATAAATGCCCATCAACGAAGCGTAGGTCGTGTCTTTGAT
TCGGACACCCTTTGAAGTAGCAAATGTGTCATGGAGACATTGAATAATTTTGTCGACCTCGTTGCATTCCTCTACACACGAAAGCTCAGCGTTTGGAAAA
TGAAGAAGCGTGCGGAGACTTTCCAGAATCTGTGATTGAGCCTCAGACTTGCTGAGTGTGATCCACCGGAACATATCATCACACAAAAGCCAGGCCAAAG
CGATCCGCTCGAGACAAAGCCACCGAGAACTTGGCGAGAGATCAGATTCAACACTCACGTTTGTGCTTGTGTCGGAGTTTTCACAGCATCCAGCGACGTA
TTGCAATATTGTGACAACTGCAGGGAATAAAGGCACTAGGAACATGCAGAACTGACGATCCAAACAGGTATCAGTACTTACGCTTGTCTCCGCACTCATT
AATGTGCTTAGCTGCCAGGTTTCAGGAAGATGCTTATGAATCGATCGCAATGCTCCGTCCAAGAGTCGAGTTACCTGACGAGGCGAGTTTGTTGTGACTC
CAAAACAAAGAAATGCCATCACTTTGACTTCCACCTGAGTCACTACTGCATCTGTGTCCACAGAGAGGTTCTGCGCACTACTGTCTAAGCTCAGGATTCC
ATTCCAAACAGTTTCCCAGTTTATTGTTTGTCTTTGAGAAGTCAAAGGGTTTTGGTTCTCTTCCAAAGCGGCCATACTCTCTTCCAGATAGCGCAAGTGT
AGCAAAATGTACTTCATGCACGTCCAGCACCATGACATCTCTGCAGGAACATTTTTAAGCTCTGTCGATGTTAGAAATTCCAACTGCTCTGTCCAAATCA
CAAGTCGCATTAGGCCAGGAAGAACTTGACGAGAGATTCTACGAAGCTCGAATTGTGAGGACTCAAATGCCTCTTTCGTTTGAGCAATACAACCACTGAG
AACCTGTTGCCAGAATTCATGTCTTGAGAGAGGAAGATCATGTCCACCACTGTTCTTCTCAATCCAAATGCTAATAGCATGTATGAGTGACACATTCTGC
GGATTGTTTAGCTCTCTCCCCTTCACTTCCTCTTCATCAGTGTCTAGTACCCATGTAGCTGCCTGAGCTTGATTGTGTGCCCAGAGAAACGATTGCAAGT
CTGGAAGCAAGTCAGCGTTTCGTTCTCGAACTCGCGTTGAATCTGGCTTCCACCTCAGCAACTTGCAGGAATCGCTCCCACAACTTAGCAGATTTTCACC
TAGGACGTTTATGAGGACATCAATGCTCAAAAGACGACCTTCTTTTTGCTGCCAACAAAAACTGCTTTCATCACTTCGCTGCTTGGATAGAGAACACAAC
ATTTGTACCATTAACTCTAAGGATGACACGCTAGGTGCTGAAGCTGCGCTTACATCCAAATCATTGATACTCGACTGGTTCACACTGCTCAAACTTTCCG
TAGCCAGAGCTAATACAACGCTACTGCTCTTCTGGCGAACGCTGGATGCGATATGCACAACATACTTTTCCAGCGTCGGAAACACGAACTTCCAGTGCTT
TAGCAAAAATGTGGTTGGAAGACATGGGGCCATCCGAGCTAAAACGTCCAACAAACCTTCCGCTTCAAACGCATCCAGTAGTTCTGATTCGTTAGGATTC
TCAGCACTCCCATTCTCGCTAGCCATCTCATTCCTGTTGATCCGATTCAACTTGCTAATTACTTCCTGGAAAATGAGTAAACGCGTTGGTTCTTCACAAA
GAGAAGAATACTCCACCAAACATTGCGCTGCAAGTAGTCGGATACTGAGTTGGTTGTGGCGAATGCATTGATAGATCGCTGGTTTCAGAGTTTGTACTAA
ACATCGTGGCAATTGAGTCAACGTGTGACGTCCATAGGATCCAAGATGGTATTTAATCACTGGCAATTGACGAATACCTAACATTCCCCTAATGTCGTCT
TTAACCTGAGAAACCTTGGGCTCTTTCCCAGCTATGGGTAGTTCACCAGTGAGCTCTGTTTTGATGGAACGCAGAAGAACCGATAGTGCCATCAATGCGC
CTTCCCGTTCAGTCCACGCGGTCACTTGGCTTTTGTCGGTGCTAACACTTCGGGATCCGATAGCTACGCAGAGTAAACTATCCATAAATTGCTCGATATG
ACTCTGTGATGTGAACTCAAACGCGATGTCGGCTGCAGCTTTTGCACTATCTTTCCGAATTGCGGACCACAAATCTGTCACTCCAAGAAGCAACACACGA
ACTACTTCGTCGAAGAACTTTGCGTCGGCCTCGAGCATTTTCGATAGCGAATGTTTTGACCGTAACGATAGTCGGAGTACTTGAAAGGAAAATGAAAGAA
AACGTTGACGAACCAGAGGATCTTGTAGTCGCTTAACGACTCGACTGAGTGTGGAGACACCGACTGCATCCCATTCACTCCTTAACAGCAACCTACATGT
ATACAAAACGAAATTTACACTTAGGTTTTCAGTATCAGACGTACGACGAACGTAAATGTATCGTAACCTACCCATGCAAAGTTTCCACAAGACTCGTGAA
TTCTGTAGGTTGTTGTTCATTGCGGCGTCCCCAACAAACCAACGTCTGCTGGTCAACACCTATAATCACTTTACCTCCTGCCAAATTGTTAGAGGCCCCA
AATGTCCGGACAACCAAGTACAGTAGTAGGTCCTCCAACAACGACTGCGAGGTGCTTCGACTTTCGTCACCCCCGTCAAATGACAGAACTGGAGGTTCAG
AGCTCAAAAGTCGAAGATCTAAGCAATGTTCGCCTGTTGGTTCCTCAGGTCTCACCAAATAACGAAGTGCTTCACTTTCCTTGTCATAGCTTACAGCCAA
AAGCAAACGCCGCGCCGACGCCATAAAGCTCACTAAGTATATTTCGTCGGCAGTTGCTAAGTTTGAGTGCACTCTTACCCACGAAAAACGCACACATCCA
AAATCGTAACTTCCCTTCCTTTTCGTAGATTGAAGGAACATAATACTTTGTCTAAACTCTATTTGAGGAGATTTACGTGACACATTCAAACCTGTAGGTA
TTGTATAGCAGCCCTCTCACCTTTCGCCATCCGCTGATGTCCACGGATCTGACGCTGAATACATGCTCGCTGGTGGGAACTGCCAAAGTTTGAGTTTATC
TGCTAAACTCGGGAACACATTTGCAATTTTCTCTTCCAGTTGTTCGTAAACGAGTTTGTTGCCCGACGAGTTGAAATGCAGACCATCAGCTATCAGAAGC
GCGTCTCGTGTCGACTCGTTCATAGCGTTGAAATACGAATTCAAATCCAGCACAGGGACGCCGATACTAGCGCCGGCTTCTACACAAGCCTGGGCATATC
TCTTCGCCATCGCATTCGTGCGGTCAATCGTACCATTCTGCCCCTTGGCGATCTCGGCTCTCGCTGAATCGTTGACATGGGGTGGTGTGATCAACAAGAT
ATCTGCAGTGGGTGCTGCTACCGAAAACTTGTTAACGATTTTCTTCAAGTTGTCCTTGTAGTCCTCAATCGGAACGTGCGTCTCCGAGTCGTATCCACTT
GTCAACGCAGCATCATTGGCGCCAAACCAAATCGTGATGAGAGATGGAGTGACATACACACCCTTCCTGATCTCACGCTCGATCGTCGGGACGATGTTTT
TAAGAAACCATTTCGTGTTGTAGCCTGAAAGTCCTCGCGAAACGACATCGGCAGTGCGTGAGTATTTTTCCTGTAGCAAGGCAGTCCATCCACTCTTCGC
CACATTAGTACCGTGCTGCGTTAGCGAATCGCCCGTCAGCAATACCACTGGACGCAGATCCGGTTTAGTGTCTGCTAGTGCAATTATCAACCAAGCAATG
GCGGAAGATGCAGCGATGGCGCCGATCACGGCGCATTTGACACGGAGAGAAAGCGGAGGCATCACCTTCGCAACAAACAGCAAATTCGGTTGTGACAAGA
GGTTTGTGCACGGCGGAAGATCCAAGATGATGCACGGAGCTTGTTGTAGCACAAACCACGGTGCCAAGCAGAACAGGCATAATCTGCGACGAATTTCTAG
TGGACACATCCAGTGGTCTCGTGAGGGGGATCAGTTTATTAATCGCTAAGCGGTAGTTTGGCACAACCTAGGAATTCATCATCGCTAAGCTACGGCGGGT
GTCCACGTGCACGTGCGCTCACATATTCTTGGTGGAGGTGAGATGGTGGGATGCTGCATTCCGCATGCAATGCACGACTTCTAGCTCTTGCGCCGCAATC
CAGTCAAACCGGTCAAATCGGAGCGGATCCTGAGCAACACCATCAACTTTGTCGATGTCACCGATTGAGAACAGCAGTGCTAGCGAGTACTGTATTCATT
GGACCAATAAAGCAGGACATGAAGCCGTCGCATTAGACAACAAAGTTTATTGCAAACTACAGACGAAATGCACCTGGTTACGGCGTTCACCAAACATGCA
AAGTTTGCACTGCAAACCTGTCACCAAAGATTAGCCGGTGCTTCTGGGAAAACAGGATATTCGTGCAGCAGCAGTTCGTAGTGCACTGTTCTGCACAATT
CACATGCCAATCTTCATTACAAAGTTGATCATTAACAGTCATAGCTACACAGATACATCACCCACATCATTAATTGGAATCGCTTAGTCATCGCCCTCGA
CATCCGGGTCCACAATCTGGCGCAGAGCGTCCGGCACAAAGTCGAACGCCGCATTGTCCTGGACGGAGTACGGCTCAATGATGCTGGTGCCGTCGTCGTG
GGCCGCGGTCTCCAGCGCATCGCATGCCTCCAGGAACGTCATCGAGTCCAGCTCGTCGTACGTCAGCTTGGTCGCCTCCATGAACTTCTGGATACGGAAG
TTGCGGGCCAGTTTGTTTACCGTGATGTTGTCGGGAGACTGCACCAACTCCGTGTCTACAATGTTGATGCCGATCTCGGTATCACTGGTCATGCTACGGC
GGTTCCAGTTAGCTGAGCCCAATGACACATACACGTCGTCCACGATCACCAA