Description :
From Genome Similarity Track
Location :
contig_38:147401- 159359
Transcript NameFunction/comments
g7071.t1hypothetical protein
g7072.t1hypothetical protein

Sequence
11958 bases(100 bases per row)
TTTTGTGTCATATCAAGACTGTACGATCCTGACGCGTTCACTGAGCAAATCTTTCTAATGCAGCTGGTACTCGTAGCCTTCCCTTGTCTTCTAATGCGAC
CCCCAACTAGAAATAAGTCACCATCTGGAGAGGAAGAGGAGTCGACATCAGAGGCGATAGGCAGTGCTGTTACTGTTCCGGTTCGGGCATATAATCCTGC
CGAGCTGCATCCATCAAATGACCCTTGAGTGTTAACTTCGGTGCGGTTCCACTTTTGTGATGTAACGGAGAAGCACCACATATCACACAAATAGGTTCCT
GTCCGATTAACACCTCCAAAAATCCAAAGGTTGCCAAGATCGGAGCACATGCTATAGCTCACTCTTCCCTCTGGCAGCATCACTTGAAGATCGGGCCTTA
TATTCCCACTCGACAAACTACCTGATACATCTCTCGAAGCGCCAATATTATCGTCGTGACACAAATGCCAAAGCCGGTCAAATGTATTGTACCGCCAGAG
ATCCGACCGAAATTTCTCTTCGCGATCTTGCCCGCCGAAAACGTACACACATTCTCCAATAACAGCGGACGAACATCCGATTCGTGGGCCAGGATCCAGA
GAAACCGAGCTAGGCAGTCGCGACCATGCATAATCATCGAGGGATAAGTACCAGGCGTCTCCAAGGACCTCGTTGTCTACTGATTTACCACCATACATGA
AAACGATCGCGTCGAGACGAACGCGAATTGTCGAAGCCGTATGGAACGCACGAGATTGGGGCATTGAAGTTGCCGCCCCAAGAGCAGCTTGAATTAAAGT
CCATGTCGGAAGAGCCATCAGCGTTCTTCGTTGTAGGGCATTTGTACAGATCCATATGCCGTGATGTTGCACAATTATTCTCGCCCCCAAGCACAAGGAT
CTGATTGTCATCAATTGCAACAACCTGGTGATTGCGAATTCCAATGGGTAAGTCTGTCCACCTCTCCCAGGTGCTAGTTTCCGTATCGTACGCCCAGACG
TGGTTACTTGGTTCAGTAGGCTGGGGCATTGGGGCATCCGCAATAACCATTCCGCCGACGACAAACAACGTGCTATCCGCTAAAACTGATGCAGATCCTT
CAAGTGCCGGTGGATGTATTGCTGTACCTCTTGCTGGCTCATCTGGAGGTGGCTGAATTGTTGCGGTGGAAGAGGGCGTAGTTACCGCGCGTGAAATACT
GTCAAATTCATGACCAATCGACGGGGGGTATGCGAACGGTTGGTGTCCTAAATTGATGCGGATGATTTCACCCGTTCAAGACTGATGCCAGGCATCATAC
CCGATCGCTTGTCGTCTACAGAGCACTTGAATTCAGAGTATGCGACACCCAGGTTGACTCCATTTCGATAAAATGTCATCTCCTGCGTGTTTAAGTCCAG
CAGGCAACCGATGATATCACCAGCTCTCCATTTCTCTCCGTATGAAGATGATCCACTATTCCAGCGTCGCTGGCGGTTACCGTCGTACGACCATGAGTGA
GCGTGATCTCCGACCCTTCACCTTGGTCTGAGCTTCCCTGAAAGTACCCATCGATCCACCCAACTTGAATCAAGCCACTTGTGACCACCTCTACCTCATA
AAACCACTTCCCTCGAACATAACGACACACCGATTGTTGATATTGAACCGAAGTTACTCAAGCCTTCGATCTCGCCAGAACGATCAATATCAACACGACC
GCAGACTGACGTCACACAGCTTTGATCCAGCATAACGGTATCACCTTCATCATTATCGCGTTTTCGCTCCACAATCAAGGACGTGGTATAAAAACCAGCT
GCAACATCCAAGCACCGACGGGAATTTTTCTCTGGTCGAACTTTCAGAGGAACAGGCAATAATGCGTCTGCGCTGCCTCGATTTCCAAGTTGTCCCTTGT
TATTCCGTCCGAACACGTAGACTTGGCCGTGTTCTGAAAGTAGCACTGTGTGATAGCACCCACAAGTCGCCCGCATCATTCGCGTATTGGCGGATAAAGC
TACAACATTTGGAAGATTCTGGTGAATCTTGTTTCCGATACCTAGTTGCCCGTAATCGTTCCGACCAAATGAATAGGTTCGTCCACCCGTGGTGACAACA
ACCGAATGGTAGTAGCCGCATGCAACAAAGCATACCATTTCGTTCGGAAGTGTGACGATAGTGGGTATCTTAACTTGACGATTGTGAGCTAGGCCCAACT
GCCCATAGTCATTCTTTCCGCAGGAAAAAAGTTCTCCGGTGGCTGTGCAAATGACGGTATGGTACAGACCGCACCCTACCATTGACACTTCAGTACCTTC
GAAACTCTTCACAAGCTGCGGTGTGGATTGGTGCTGTGTGTGATCGAGACCAAGTTGGCCACAATCATTCATGCCAAAAGTGTAGAGTTCCCCGGAATCC
GTGATCACGGCGCTGTGGTGGTAACTCACAGAGGCAAACCCAAGCTTCTTTGTCTTCAATGATTCAATAAGTTTTGGTACGTGAATCTTGGTGGCCAAGT
TTTCATGCCCCAACTGTCCCCGGTCATTGTAGCCCCAGGAGTACGCTAGCCCAGTGTCCGTTAGCGCGATCATATGCTCGCAACCGTTACTCGCTGCAAT
AGATTTTATTCGCTGTGAGCGCAGAGCTTGCACGGGGCGAAGCATCATTACCCTCTCGTCGAAGTGACCCTGACCACACTGACCGCTTTTGTTCAATCCG
CAGGTTAGTACGACTCCATCATTTGTGAGAATCGCCAATGTTTCGTTGCCACTGACCACCTGACGAATATCGTCCCACCCACAAAGAGCTACACTAGTGA
GTTGATGCCGCTCAATATCATCTCCTGTGCCTAGTTCTCCGTACGAGTTCTGACCACAGCTGTACAGCTCACCTGAGGCCTCACACTTTCCATACATAGG
CTGTTCTTTGAGCGCGGCAAGTTTGGCAATTGATGTCTCCAAATTCACTGCTCTCGTTGGTGGCTGCTTCATTAGCCAAAGTATCACAAATAACATTGTC
GCAAGCGATCCGCGGGCAAGGCCCACCTCTGCTAGCGTTTCGATCGTGCAAGCTCCGATATGAACTTCACTTTCAGATGCTCCATCATCCACCGGGTATG
CCAGATCACCTAAGCAGTCACTTAGCAAATTGAATGCTGACGATGCGGACGGTGCGAGGTACATACTGTCCGAGTAGGCAGTAGGCTTCAAAGGTTTCAG
GGTGGCCTTCACCATTTGCAGTGCGTGTTCGTACTGTTCTGGGTTGTTTTTGCGTGTTGCCTTCAGTAGCATGACCACCAGGTCCCAGCCCATTGTCATG
CAGTTCTGGGTCGGTAGTGGCAGCGGGGGGGCGACACTTTACGCAGTGACATGGCGTGAGCTCTTGCAGCCAGGAGTCGTTGTTCGTACCGGTATTTTTC
CTTCTTCGTCATCTGGTACAATGCCTGCAAGTTTCTCACGTAACTCGCCACCCGGGCGTCGAAAACGCCAGGCATCGCCTCACCCGCATCTCGCTTACTG
TCTTGTCGTGCAGACTCTAGTCCGTCCTGGGACGGCAGCCCTGCCAGCTGTGAAATGTGCTGGAACAACTCGTCCACCGAGTCCACGGAGCTCATGAGCT
CCTTCATCTGCTGCTCGGGACTGCGTGTCTGCAGTCGCCCGGACACTTCACTCTCTGTAGGGGCACAGAGGTAACATACACGAGGTCATTCCCTCGTTGA
AGATTGAAATACTACCTACTAGAATTGCGTGTTACCTTTCGGTAGGTGCCGCAGTGCGGCGCCAAACTCGAGGATCTTGTCCATTACATCTTTTGAGTCT
TCGGTAGCGGACGGGACAGACACGTCGCCGGCTTTGAGCACGTCGCAGAGCGGGACGTATGGCGCCTGGAGCGGCCGGAGCAGAGTGCGCTCGCCCGGCG
GCTGCGTCACCGCGGCCGGAAGCGAGACCTGCTGCCCCATGACCCGTCGCCAACTCGCAGCTTGCTGTTGGTTGTCTGCTGTGTCTCTTGTGCCTCTGCG
CGCCAGCTCAACTCGATCAGTGGCGAAGATCATCGGCCCGGCAGCCGCGACTCTTCCGGCAAAATGTATCTTGTGTTCGATACATAAAAAACATGTTGAT
TGGTTGAAAATAATAGTGCTGTTATGGGCGATAAGTGTTTTGTTCCTTAAAAAACAAAACACTCGTTATATAGCCCGATTGGGTAACACGAGACTGTCCA
TTCATGCCCAACGAGGCCCGATCCTGGTGCCCGAATGTGCCCGACTAGGAAAGAGTCGGAGAAGCATCGCGCGAGGAGTCCTTCACTGTATACGTATAGC
CGGACATTGGCTTGGAGCGTCGACTTGCATTTTTCAACCAAGAAATCGCCACTCCGATATAATATATACAAGTTGAAGGCATCGTGCAGCATGTCAACCT
GGTCCCATGGGGAAGAGATTAGCATAGATAGAAACAGGTTCTCTTGAAAACGAGGAGCGGTACCTTTCCCACGAGTTCTTGTACTGTTTCATCGCGTTGC
GTCACTTCTCGGGCTTGAATCTACATCCAGACGCCACCGCTTAGCTGCTTGAATACCATTTCACGGAGAATTGACTCCTCACCTCAAGGTTGTTCTTGAG
CTCTTCAACATCTGAAACAAGAGAATTCTGCAAGAAACACAGCAACAGGAACTCAATCAGTTCAAAACAACAAACAGCAGTATGTAAGCCGTCGTACGGT
CTTTTTGTCAATGACACTGCTGATAAGGACTTGGCGGTAGTCGCCACCCCCGCCTTGGAGCTTTCTGTAGGCCGGCGCAGCGCCACCATCGATGGATCAG
GTCCCTCGCCTGAGCTTCACACTCAGTCGGCGCACGCTATCCGTTATGTCCGTTCCGGGCCATGCTGTCGAGTGCAGCCTGCGACGTGGCTATTGGTGGG
CAGACGACTCGCTTTGCCGGTCTTCTCCGCCGCTTGCTGAATCGCTGCTGGAATGAGTGCAAATGCGCCGCGGTCGTGCTTTGAACCATGGAAAGCACGT
GGCTAGCGATGCATTCGAGCGGATCCGCACGGCAGAGTTTGTGGCTCGTGTAGCTTCCTATCCGCATCAAAGTGGAGTCCACGATGGACCGCGTCGACGT
GCAAGACATGGACTCGGAGACGCAGCAGTGCCGCACCCAGCTTCTTCTCGACTAGCTGCGCGGTTTCACCAACGGGACAGCTGCTGCAGCCTGCCGTTGG
GCCGTCGTGTTAGCTATCAAGAGACTGTGCCAGAAAGAGACTCTGTCAGCGGGCGCACTTACGATCAGAAGAACCCAAATCCGTCCTTCATCCCAGAGCA
GCTCGAACTCACGTTTGATCGAATCAAGGTGCGCCTGAGCCGTGCGCGTCTCAAACGTCTCTGCATGGCGGGCTCCATCGAACGCGACCGTGCTGTAGTT
GCCCGTGCCTTGTAAACCAAACTGCCAGCTCGGAGTACCCGCTGCGGCACTGCTTCACCATCGCTTGACGCTACAGATGAACATTACCGCGGCTATCTAT
CTCAACTTGCCAGTTGTTTTGCACGGCAACAGACCACATGTGTTCGTCAAACTCAACGGCGTGTGCTCCAACAATAGGACCACGCAATACAACAGTATGT
TCCCAATTCAACGTCATTCCCCCCACACTCCAATTGCAGCTTCCCATCGTCAACACTCCATCGATAATCGCTACCTTCCAGTGCATGAGTCTGGGGCCTG
CGTGATATACGTTGACCCCGTTTTCATCATCATGCTGAGCTTTTCTCGGTGACTTGTGCCCGATCAACGAGAACACGAACCGTGACACGCTGGGAGGCAC
GGATGATAGCGTCGGTCAGTTCAGGATGCGACAAGATGAACATAGCGATATCTACTGAGGTCTCTGCGCCGTCGAGCAAATCAATGAGCTTCTGAGGTGC
AGCTTGGTCGCGAGAAAACCAGTAGTCTACAACTGCAGTTTGTAGTCTACCCAATATGTCCTGCTCCATGCGGCCAAATACTCGACGGTCGACCCCCATT
ATTTGCGATGTCCTTGAGCGATGGGTTTTCCGTGACGCTAAGACCTCGTTTCAGCATTTCCACCACGAAACGCATGGGGGTCCACCGACAGGGTTTACCT
GACTTGGACTCGTCTTTGGGCTGGGCGTGGACGATGGCGTCGATCGTGCGGGCGTGTCCCGTGCTTTGATGCAGCTGGGTAATTCTCTCCCCTTTCTGGT
ATCGCATGCGAATCTGGGACTTCTCTGCTGGAGTTAGTCGCGGACGGCGTTTCTTGGGCAGCGGACTTTGCGTTCTGTAGGCATTCGGCACGACGCGTCG
CGAAGCAGTGTACATTTGACGTGCTAGGAAAAACGGAAGTGGCCCGACCTCCGATCCTCCACGTTGACTGAAATAATAATGGCTCGGAAAGTCCGATCCT
CGACGCTGCTGTTTAACTGGCTCGGAACGTCGCAAAGTGGGCAACTTATCCTCGAGTCGAGGATAAGTTGCCCACTTTGAAATTTCCGAGCCAATTAATA
CAGCAAAAAAAAATGTTGGGCAGTGGGCAACTTATCCTCCACTGGAGTGTGAATTGCCCACTTTCCGACTTTCCGAGCCATTTAACCCTTTCGCGACGCC
CTTGGATAAAGTATACTATACAAGGTCAAGATACTCCGATCTAAAAGGGCACAAAATTCGCCCTTTAAGGTTTTCACGGTACTCGCGTGAGGCTTGAGTG
CTGTTCACTATCCCCCGGATGCGGGATAGAGAAAGCCGGACGGTCTAAAAGGGTACAAAATTCGCCCTTTAAGGTTTTCACGGTAGTTTCCAAAGACGCA
GCGGATTGGCTCATATTTTTTTTTCTTGCGGCGACTAGACGAATTCGACGATCATTGGTTGAAATGCAACGAAATTTACGCAGTAAGAAATCGCAGCCTT
CGTAAAATACCATACCAGTCTCGTCTCCGCGCGATGACGCGGTTGAAGCTGTGTACACGTCACTACGATGGCGACGCAAGCTAGTTGCCCTGGGTTAGCG
AGGCAGGCAGCCTGCCGCAGGCTAGCCGTGGTCTGTGCGGGACACGTCGTATGGACGTCTAGTGCAGTGGGGAAAGGTAGCTTAGCAGAGGAATAGATAG
ACCAGAGAGTTGAGTTTACAAGGCTGTTAGCAGAGATGAGCGCTGAACTGCTGTGCGCTTGGCTATTATGAATTGTGAGTTTTACTGATTTGGTCTTCCA
TATATGCATCTGATTGGGAAATCCTATGCCTGTCTGTTCCCGCTCTATCCATAAGCACCAATGGGAGTAAATATCTCTGTCTCACTATGCCGTTGACCGA
TTTACTCATCCAAAGAGACCCTGGGGTGAATTTTAGTTTTTGGCGCGAACCTATAAAATGATCACCTTCCCAAACCGATTGGTATCAATTAGAGTAATGA
ATAAATGATGCATGGCATCATAACTCTATTAATTTATGCCTTGAGACATAAAACCCATGCCGCTCGCAGGCCACACAACCGATTTTTCTCCCTCGCGGGG
ATGCCGAAGCGCGACCGCGATGAAGCGCGAAAAATGATAGAGAAGCGTCCACGTCGACGGGTGCGCCACCTAGCGAGCGCAGCAAGCGATCTGGGCGGTG
TCGTCGCATTCAATGACGTGTGGACATGGCTCAAGAAGTCTGGCTGGTATTCTAAACCGCCTCCCAGACGTAGTCTGGACCTGCGCTATCGCTACGTTCG
ACCGGATGGTGATGCAGACGGTCAAGAAGGCGTCGATTACCTTCTTGGCGAGGCTGCTGTTCTTCGGTATGCTGCCGCCCTCACAAGTACGAGTCTTGCT
TGTGTGAACGTTCGCGGCGGTGGTGCTAACGACGCATGAGGGGTTGTTATGTCATCAGGGGGCAGAAACGACAACGGCAGCAACGAGCATGCCGAATCCA
GGTCAAGAGTGGACGAAGATCGAGGAGGGCGCGAGCGCGGGCGAGGCAGTGATGGCCGCGATGGCGGACATGGCGTGGCACCGGGTGCGTATCCGATTGA
TTCAAGAGTAGTGACTGCAGCTGATGGTATTTGTGCGTGGTGGTGCGTAGCAGCAACAGGCAGTAACAAAGACGGCAGCGGTAATCTGGCGGCATCCAGG
CCAAGTGTGGATGGAGCTCAAAACAACGCGGACACGGTCGTGGCAGTGGTGGTGGCAGCGACGGCGGACGTGGCAGTGGTGGCGGCGACGGCGGACATGG
CAGTAGTGCGGCGACGGCGGACGTGGTATTGTTGGCGGCGATGGTGGACGTGGCATTGCAGGCAGCGACGGCGGCCGTGGCAGTGGTGCTCGCGCTCGTG
GACGTGGAGGCGGCGACGGTGGACATGGTATTGTTGGCGGCGACGGCGGACGTGGCATTGCAGGCAGCGACGGCGGCCGTGGCAGTGGTGCTCGCGCTCA
TGGACGTGGTGTTGTTGCTCGCGATGATGGATATGGTATCAGTTGCGGCGGTGAATGTGGCATTGGTGGTGGTAATCGTGGCAGTGGTGGCCGCGTCGGC
GGACGTGGCAGTGATGAAGGACGTGGCGATGGAATGGGTGCGTAGTTGTCTTGTTGCCGTCTGCTGTTTAAGCATTCATCATGTATGTATTAATATGAAT
ATTTGTATACTTGTTGTAGTATCAAGCGCTGTTCCTGGGACGCCACAAGCCACAACTCGGGGGCAAACGCCCGACTCGTTACATCGGACCCAGCCAGCGA
GGACACCTCCGATAATGCTGCAGGAGGTATACATGAATAAGTTGGTGGCATTCACTCCGGAGCGCGAGACCTGGATGAAGTCCAAGCTCTACCGCCCTAT
CGGACCGGCATACATTGTGGGGCGTGTTTGCCGACGTCCGATGCGAGGAAAGTTTGCGTCACTGTTTGAGATCCGCTGGCTGGATACTCAGTTCCAGAAC
GCTGTGGAACATGTGAGTGTCGGATGTGTTCAATCTGGAGTGGAGAACTACAAGGAGCTTACCCGGTTGAAGGACAACCCCGACTGGCAAGGGCTAGTAA
CGGGTGACGCCGACGATGACATTGACGTGGATGATGACGACAATTTGCAAGTGGTGGAAGAATACAGAGAATTTGATCCGGGTGTTTTGCTTCCTGCCAA
TATGGAAGAAGTCGAAGCGATTCGAAATCTGCGATTTGAGCCCAACGGAGAAGTTGACGCGCCGACTGACCTCTACCAGCTTGCCGACGGCTCAACGAAA
ACGACCCTTCTACCACAGTATAAACACCTGTTTGAACACTCGGCCACCTCCAGCTTTTTTGCGTACCTGCCTCTGTACTTCTGGCGCCAAGTGCTGTTTG
AGACGAACAAGTATGCTATTGTGCACGACATCAAAATTGGAGCACCATTCACACTCGCGGAGCTGATGGCGTTTCTAGGCATCATGTTTTATATGGCCTT
GAACGACAAAGGTGAATATGCGAACTACTGGGGCCAACAACCAGAAGACCTGATATTTGGTGGGAACTCCGTCTCGCTGGATAGCGTGATGTCTCTAAGT
CGCTTCAAACTTCTGCGGTGCTGCCTGAGTTTCAATGCTGTACCGACCACACTGGATCGTGACGCTGCTGCTCGTATCCGACCTCTACTAAACTTGCTGA
AAGTGACTGGTGGTCTCTATGTCAAGGTTGGACGTAATGTGGCTTTGGACGAAGCCAGTATAGCGTGTCGGGCTCGACAAGGAAGGCACATGATCGTGTT
CAATCCCATGAAGCCAACGGGTAAATACCATTTTCGGTTCTATGTTGCCTGCTGCTCATCTACCTGGATCGCTCTAAACTACAAGCTACATTGCAGTAGG
TGTGATGTTGGCGACCGGCTCGATGGCGTAGTTGGACAGGAAGAAGCACTGTCGCTGCGAGTAGAATTTGACAAGGTGTCTAAGATTCGACAGCACGTGT
TGGAGGTCGTGAGGCCATTTTTCGGTACTAACCGCATCATCAACATGGACAATTACTACACTTCGGTCCAACTGCTTCAAGAGCTGAAGCTCAAAGGTCT
TTACGGTCGAGGAACCATCAAATCTAACAGCAAGCACTTCCCTCGTCACACGATCCTGGATGATTCTAAATGTACGCGCGGCGACCTCCTCCAGGCCATC
TCCCATGATTATAGCATGATCGCTGCGTCATGGTGCGACGGCGACATCGTCAACATGGTGTCGAATGCCGACCCATCTACGATTACACCTGTTACAAGAA
TGGTGGGCAATTCGTCACAAGAATTTGCTGCTCCGACATGCATAGGTCAGTACAACCAGAATATGCAAGGGGTGGACAGGTTGGACCAGATCCGAGGCAG
ATTTTCCATTGCAGATGGTCACTCCTTCAAGAAGTGGCATAAAAAACTTGCCTTAGCAATGATAGATATTGCTCGATCAAATGCGTATTTGACGCGGCGG
CTAGCAGGAGTCGGTCCTCCTGCGCGTGATCCACATCGCGAATTTGTCATGGATTTGGCGTGTCAGCTCATGAATGGCAAGTGGATCGAAGCTCCCAGCG
AGGGTCGTATGGTGTACGGAACTAGTTCACTAAACGATGTCGTGGATGTGGAAGGCGTTGTGCCGACGCCAGTGTCGACCCCAGCGCGAACGTTCCCGTC
CAGCGATGCACTGCCGTTGCCTCGAAGCAAATTCACAGCAAGAAGAGCCGGAAACGACGCAGATGTGTTGTGTGCCGCTGGGAGGATCGCTACCCTACAG
AGGTAACAACATACTGCCTTACTCACAGTGTGTCCTTGTGTCAAGAAGTAAACGAGAAGCCCCCAACGAGCTGGATGTGTCCACAGCAATCTTGGACATG
TTGGGATAAATTTCACAGGTTTTATTTGCTCCAAGATCTGTTCACCGTGAAAGGTAACATTCGCAGGGGCTCGTCTCTAGCTCAAGCTAAAAGCACTGCT
GCTGAAAGTAATCCTACCAAGCGCAACCTACCTGAACCAAGCCCAAAGCCAGACGTTGTGCGTCAAATTATCTTATAGCTTCTGTCGTCGGTGGGTGAGC
TGCTGAAGCTGGCGCGATGCTGGCCAGGTTGTGCTGCTGCTGGATGGGATGGTTGTGCCAGGTGATGGTCGGGATGATGGTGTGAATATGCTGTCGGCCA
AGCTATTGGTGTTCGTGCAGACGCGTTCCTCGCAGTGCTCAAGAAGTTTGTAGTATTGGTGGTTTTATCACTACTTTTGTTGTAAATATAGATCGGGGTC
AAATTAGACTTCCAGCTGCATTCAACCATCCGTTCGTCGGCTAGCTTCCAGCGGAGACAGAATGGTTGCGAACATCTACCACTGTGTCGCGGACAGAAGC
GAGCAGTCGCAACAATAATTCGTGCGTTTGGCATGGCGCTAAGTTCTTGGGCTACAAACAGCTTTGCTGATTCTTCGAAAAGAAAGTAATTCGCGTAGAT
AATTGTAGCATCACAAGTTGGACTTCGTACAGATAGTGCCACGTCTCGTACGTCTGTAGCCTTCATGACCACCTTCCGCAGAAGTGGGAATGAATCAGCA
TGTCTTTGAATGTGCTTTTCTCCGAGAGTACACAAATCAGAGCGAACTTCGACCCCAACACATTTGCTGATGCAGGTAGTAAGAGCAACTTGAGCTAGTA
CATTGCCAATACCAGCGCCCACATCAAGAAAGATGTCATGCGTGTTCAATGGCCCCAGAGCCGTGATCATGGCAGCAACCCCGGATGGCAGCAACTCCCC
CGCATTGTCTTGCGTTCTACCAGCGTCCTGGCGAATGTCTCCCGCAGTAATATTGCTAAATACGAGGTCAGGACTCGTATTGCGTCATGCAGCGGGAGCA
ACGAAGAGCATGACGTCGCTGGCAATCGGGGAGGAGCCTGAAGTTCCAGCACTGCGCTGACCGACTGCGTTCCCAACGCATTACCAGGTCTCTTCACCAC
TGCGCACGCCGACGGCTCCAACGCGCAGATCAACTGCTCCATCGCCGGAGTGATCGAC