Description :
From Genome Similarity Track
Location :
Scaffold_290:14740- 15833
Transcript NameFunction/comments
Phyag_g4362hypothetical protein PHYSODRAFT_485789

Sequence
1093 bases(100 bases per row)
GGAGCAGGGTCTCGGATAGCAGGTGTCTGGAGAAGTTGTTCATGGCGCTCAATTTTGGCGTTGAGCGCGCCAGCACGGTGAAGACTACGCAGGTGTTTCA
AGACAGCGCCAGACCCGCGTGAGTTGATGCCGTGATCTTCGAGGAACCTCAAGACTGATTTTTCTGCACAGATTCCCAGGGACAGCACCTGGTCGCGGTA
GCTGGCTTCTGTGACATCAAGCACAAAGCCGTCATCCAAGAACAGCTTCATGTAAGCGATAAGCTGCTTTGCGTcggacttctgctgcttcgagatgGGT
GCACGCCACAACGGTGGTTCTTGGGCGTACCATCCGTACCAAGTCGTATGAAGGTGAGTCACTGCTGatctgcgctgcttcttcttagCTTGACTCTCAC
CGCATTGACTAGTTTCCGGGTTGTGCCGTTTGCGTATTTCTTGCCTAGGGTCGTtctgaaacagggcgagacgcgctctgtttctttagcatacactagt
atgcgcttttgNTTCACAGGGTAGCTCTGGATTTGCGAGGTGCGACGACCAGGCCAGTAACTCAACGAGCGAGCATCCGATCTCCGTGGTACAAGCTTCG
ATTCGTTTAACTGCAGGTGCTTCAGCGTTCAGACGTTTCAGCAGCGGGTAGTGGCGGATCACAGTCGAGGTAAGCACATCAAGGACAGCTTGGTTAACGT
TGTACTGTGTAGCTTGGAGATTGTGGCATGTGCTGAACAGGTGACGCTGGAAGCTGGAAATCGTGCTCCTTGTTTGCGAGTCGAACGAACTCAAGTTCTC
GAGCGCCACGTTTTTCTTGGTATTGTGTCCACTGAGTATCTTGCTAACCTTGTGGTCTTctttgctggtgttgaagATATAGTTGAAGCCCTTGTTCGTG
GTGCTCATGTTCCAGGCGCCTCTGTCGAAGATCCAGCGTTGCGTCAGGCCATCGCAGCCGTTCGCGTGTTGTGCGCCGCCACGACGGAACGAGTGCGACG
TCAAGGCATCTGCAACTCCTGCGGCGCTGGCTATGCGTTCGAGCACGCGGTTCACGTGGGCGTAGTGTCCACGGGTGctcgggcagcagcggc