Description :
From Genome Similarity Track
Location :
Scaffold_543:1474- 5217
Sequence
3743 bases(100 bases per row)
TGCCTTCGCGATTCGTCGCCTCCGCTCAGTCTGTACTGTCACTGGATCGATGTCGTTGGCATTCTGAGCTGTCTGGGATGACTCTATCTGCGCCCCTGTT
TCGACATTCGGGGACGTGTGGTTAGTCCGCCGAGTCGATGCCCTGCTGACTTGTTCGAATTCATCTCCACTGCTTCCAAACGCAGATTCTCTTGGATTTG
TTGACACCGGTTCGTGATCCTGACTTCCTCCTATTGCTCTAGCCGAGTCTTCATCCAGCTCGTCCTCAAAGTGAACTCGGCGTACTCGGCTACGAGTGAC
TGCCGTGACAATCGGTGTTTCCGCTGGGTTGTCTATGGCGTACAGTTTTTCGGCTACTCGGTTAATCATTCTCAGCTCTACTTTCCTATCCGTCCCGAGA
ATTACTCGTCCAGCTTTAGCTTCCAGTGCTTCTGTAGCGAGGGAATCAGCCGCTGCGTTATAGTGTCGCGCTATGTGTCGATACCGGACCGAGTTGAGTT
GTTTCGTGAGATCCTTGTGTCGAGCTAGCTCCACTTGCAACGTTTCTTTCTTGCATGCTATCACCCCCATGGATTGCTGGATTGCAAGCCGGGAGTCACA
AACGATAATCAGATCGGTTATCCCTCGGTCAATCGCCGCCAAGACTCCATTGTTCATGCCGGTGTACTCGGCGATGTTGACTGTGGTGGACGACAGGTAC
GCACTCGCAGCAATCTCAATGTCCCAATTCGGAAGGCACCACAGTATCCACGAACAACTGCCATACCCGCCGTATTTAGCCGTCTTCGCTGAGCCATCAA
ATGACAGCACGCATCCTGCAAAGTCAGCTGGTATTCGGGCATATAGCAGCGCTGGGTCCATTCGAACTGTCGCCGAGTTCTTGGAGGGAGGCGCCAGGTG
CTTCAAGGAATCGTCGAGTCCGATAAACGGGGTTATCGACGCCTGGAGCAACTGGGCGAAGTCTACATCTCGCTCACGTACTCGCTTCACCACCTTCAAA
TCGTAGGGCGACAACATAACTGCGAAACTGACTGCGCGGCCGTACAGCGACTTAGACTTAAACACCCACTCCAACGTGGAGAAACGGGTGTAGACGTGTA
GCGTCTTTCCCGCCAAGAGAGTGTAGCACACTTTCAGCAATTGTAACAGCGCGACTACTTATTTCTCAGCGGGATGATAGCCGAGTTCATTCTCCTTTAG
TACGCGTCCGCAGAAGCGAACTGGGTGCAGCTTGTCGTCGTGCGGTTGCATCAATGTACTGCTTAGTTCCCACTCATTGGCGTACAACATTATGTGTACT
TCTTTCGCCGAGTCGAAATGACGCAGAATTGGAGCTTCTGCTACCCGTCTTGTGAGCTCGGCGAATGATGCTTTTGCTGACGCTAGGTCACCCCCAGGGC
CAAAGTCCGTATCCTTTAGCTGATAGAGTACTGCTCCGTAAACAGCCAAGTTCTGGATGAATCGGCCGTAATAGTTGAGGGCACCGAGGAACGCTTGCAT
CCCCTTCTTCGATTTCGGGAAGGCGAGCTCGGCGATCGCGGCTATCTTCTTCGCATCAGCGCGTATGCCACTCGGCGTAATCTCGTGCGATAGGAAATCA
ACCTTGGGTTGGATAAAGATACTCTTGGTAAAGCTGATGCTAATTCGACATTCTGTGAACCGGGCTAGTAATCGGTCGAGTGTCTCCAAGCAGGCGTCGA
ACGTCTCCCCTCCAAAACAGATATCATCGACAAACGACCTCCGCTTGAACACCGGAATCAAGGAAGACTGGTCTGGTTCTCCATTAGCAAACATGTCGCC
GTCCGGTCCGTTGACCAGGTCTTGGACCGGATCGCAGTCAGCTTGTGATTGGCGGTCAGCTTCAAACTTCGTCAGCTGACTCTGCGTTGAATCGCTGACT
CCGCCGAGCTCAACTCGCCGAGTTCCCGACTCGGCTTCAGCAACAGCCATTCGTTCGGCAAACAGCTGCCATCCTCCCTTTGGTTGAACATATCCCCATA
GAGCGTTGTCGATCAGTCGCTGGTAAATCATAGGCGCATTCTTCAATCCAAATGGCATTCGTAACCATTCAAAGTGTCCAAATGCACAGACGAACGCTGA
GATCTGCCGAGCTCGGCGTGTCATCAAGACTGCCCAGAATCCACTCGCAGCATCGAGCGAGCAAAACCACAAGTAACTTTCCAATTCGGTAAGCAGGTCA
TCAACCAGCGGCATAGCGTATTCCATCGGCGTCGTAACCGCATTAACCAGTTTATAGTCAATGCATAGCCGAATATCCACACCATTTTTCTTGAGCACTA
TCACCACTGGCGAAGCCCAAGGGCTGCTCGAGAACGATATCAACCCCGCTCGAAGTAGCCCTTTCAACAACTCGTAAAGCTTGCTCAAGTGGCGGAGAGG
TATCCGCCGAGCTCTCTGCTTGATGGGTGAGTGCCCTTGAACGTCGATGTCGCACAATGCTCCGTACGCTGGAGGCGGCAGGGCATTACCACTTGAAATC
ATTATCCCTTCGTGCTTTTGCAGCTCTGTCACCAATTTAGCCGACTGTGCTGGCGTATGACTACTCGACTTGACGTTTGCAGCGCCATAGTCGAGTTCGG
TAGGTTCAACTTCAGTGAGGTCGGGAAGGAAGGCCAGCTCGTGAGCATAGTCCGTCAATTCCAGATCTGTTCCACTACGCTCAAAGGCGTTGGTCGTACC
ATCGTCAACATCATCCTCTTGCTCGTCTTCAGCCGCGGCGATAGCCAAGTAGTGTTGTCTTAGAGTTTCCGTTGGGTCTCTCGTTGAGTTGTATTCGTCA
TCTCCAGCTTGTCCTAAACCGTAGTCAATTCCGCCGGGGTCGAACACCGTCGCCGCTGAGTTCGTCCCTCCGATCTCAGCTATAGTACCTTCCAACAGTG
ATACCTCTGGTAATTCATGGTTGTCGGTTGCGTCAGGGCCCGTATTCGCTGAGTTCACTGCGATGGTCGATCTGACTCCTGCGTTTTCAAACTTGGCTCC
GAGGTAGATGGCATCATCGTCACGCTGTCTAATCACTTCTAGACCGGTCGTAGTCTCCATAGTCTCCAACGCTGAGTTCGCAGTAGCTGGGTCGTCGTTC
GGCTTTATTCCTTCAGGCAGTAATACCTCCCGACTATCATATTCCTTGGTCGCGTCGGAGTGATCAACCGCTGAGTTGGTTGTGACGGCAGAACTAACTT
CCGTGCATGCAAACGCGTCCTTGGTGTAGCTGACATCATGACAACATGTTGTGGCCACGTCCGGGGCACTCTCAGTATTTATATCTGCTGATGCCGAGTT
CACTGCCCCCGACTTGATAATGCAGGCTTCCGGTGTACCCATCGCTGAGTTCACCACGGCTGCAGAACTTGGTCTTCTGACTCCAAACTTGGCTTGTTTG
TCAGCAACCGGTTGGGCATCACTTAGGGCGCGTTCTGAGCGTTCGTCAAGATCTTCTCTCGTTATAGCTGAGTCTTCAGTCGCCGACACGTCTTCCGTGG
CCCTTACTTCACTTTTTCCTTCAGCCGCTGAGTTCGTGTTGACGTCAGAAATGGCGCCATCGTCTTCAAACTTGGACAGCTGATAGGAGACATGGTAGAT
CAAGAAGCGAATAATAGAGCACGACGCAGCATACTTTGGGTTGTAGTCCCCTCCGCACGCCGCATAACTAGCACCAGATCAAAAACGGTTCTACCAGAAA
TTGAAACTTTCCACCGGAAAAATCCAGCGCAAACCTATTGCAC