Description :
From Genome Similarity Track
Location :
Scaffold_111:1474- 4442
Transcript NameFunction/comments
Physo_142260elongation factor 1B-gamma, putative / eEF-1B gamma, putative

Sequence
2968 bases(100 bases per row)
TTGACTAATACTGCATTATTGTTGGGTCGGATTTCTCACAATGCGGTATCAGGCATAGCTTCGAAACGTGAGCGAATGCTTCGTAAACCCATTTGGCGGT
TGACTATTCGATTTATATGGCGTGCAGTAGCTACATGACTTCTCTTTTAGCTGCGTATACTCCAAGCAATAGCTTATTAAGAGAAAATTCCATATTTCCC
ATATTTTGCTATTCAAAAAATGTCATATTTTCTGAAAAAGTGGGAAAATTGGCCTTTCCCGTATTTGTAGAGGTCTGGTTATTAGTAGTTGCAAAAATAT
AAAAACAGCGAACGTGCTCACATGAAATTTATGCACTCGAAAGTCTGAGCACATGATTGAAGTACGGAAGTCGGCGAGATGTAGTCGAAGCTACGGGCGA
TCCGGGTTGGGAGATTCAGCGTTAAATTACCGCCTCAAGTTGTTCTCATCCACCGTGCATGTTAATTCTTTGCTGTCTGGAAACCTGAATCATGCCATAG
CGCTTGCTTGAGTGAACATGCAGTGGTTGAGCCACATACGATTTTTTCTTTTCGAGAACGCTCAGTTATCTTGCGCCGTCCGTACATAATTTATTTTTAT
CGGGAACAAAACGAATATTCTAGGTTCATAGATTTCTCTATGAACCTAGTTTCAAGATGATTGTATATTTATAAATGCAATCCTTTTTAAACCTGGCAAA
AGGCTGCCTTGGACATCGCCAGTAACAATGCCAAGATTCGTTTGTTGATCTCTTTATTGAACCACTGGTGAGTACCGAAGTACAGCAAGCGTTCTTCACC
AGATGAAACAATTGGCGGGAACCCGGGTACCCATCGGGACCCCGGTTCCCCCAAAACTACCGGTACCCATATATGATCGAATGTATTGAAGAGTTGGTCT
ACGACCTGCGTTGAACGTAGCTTAAGCTCGGAAGAGAAACGGAAGGTGAATTCGTCTCCGCTCTCGTCCTGTGTCTCTCCATGAAAATCCAAACGCTTGC
CTGGTACGGCGGTAGAGTGCTTTCCGGTCATATGGCTAACCTCCTGCTCATGTAAGGTGGACTTGGGCATGGTAAGGTACGTTATTCGGGCCTATTCAGT
ACTGGTGACAGATTTGCGGGTAGTTTTTCGTCGACAGCACCTGGGTTGATGGTTTGACTTGCCCCAACGCTACCAATATGGGGGCCAAAACTTAAATAAA
TAATTCGCGATTTGGTCGGTATCATTTGCGGGAACCCGGGTTCCCGCCAATTGTTTCAGATGAACAGCTACCGACTGAACGTCATATCAGCTAATCTATA
TATATATTAATACCTATACTTAGTACCTACTTAGAGAAGTATATTCTAATATGTAAAAAAATTACCTTATCTCAGTCGGAGACGCAGTCGCGTAGTCGAA
GTTTTACCAGTACTTAGTACTGAGTACGAGCCATAGTGGGAATCATTTGTTGCAAAAGCACTCATTTAACTAAATGAGCGATTTCGGGTCAAGACGGAAA
ATACGGGGGAAAAATCGGAAATTCACGTACTGGTAGGGGTCTGGTAATAACTACACCTTTGCCAATCCAAGTTGGCAGCAGTGTCGTTGTTACAATAGCA
TCCACGACTGTGAACAACCCGCAACAAACACTTTGGGCAAATTTTCTTTTTTTTTCTTTGTTAAATGATGCTTCCTATTAGTTAGTATGCTCACAACCGC
ACATATAATATATTACTTCGAAGTACGTCGATAACGGTTTCTCCGGCAGGTCGATCCGTATTGTGCTCTCCACCTGTTTCGTCCGGCTGGCGATGTCGAA
CTCGCCAACTTTCCTTAAAACCTTAAAACCTTTGGGCAATTACTCAGAAGTGATTAAATTGTGCTAATAAGTATTTAATACTTGGCACTAAGTAGCACCC
TTCCAATCTGGGGTCCTGAAACAAACTACCTCAAGTATCACGTGTGTTGTACGCGTACATGCACAGCTTATCTAATTTGCGTGGCAGCAAACACAACCAC
ATCATTCTTTTTCCAAAACACATCGGAGCTGCACTGTACTTGATCAGCATCAGATAAACTTCCAGGCTATGGAGTGCAGCACGTTGTGGTTATGGTACTT
GGGACGCCCAAACTACACTGCCTGCAACAACACTTTGCCCGATAGCTAGCACTTTCAGCAAGACAAGAAAATATTCCGACAGCAAATGCTGTTAATAATT
ATCTTTAACGCTAACCTCTTGGTCGATCCTTTCTTCCCAAGCAAGCACAGCAGCCACAGTAGCCAACTTACTACGGGGCTTATGAGGACGGGTTAAGACA
AAGCGACTTACTTGAACACCTTCGAGTCGGCGATGGGCTTGCCCTCCAGCTCGTCCTCGTTGCACCAGTAGGCGGCAATGCGAGCCTTCGTCTCGTCGTT
CAGCTCCGCCTTCGTCCACGTGTAGTACTCGGCGTCCGGGTTGGCCTCGACCATGTGCTTCTCCGAGTCGCCACGGAACAGCCAGCAGCCCGTGATGATG
ATCTCCGAGCCCTCGGCGCCGCACACGTCCATCACACCGAACGCGTACTTGCGCATGGCCTCCGAGCGCTGCAGGAAGCCGCCCACGGCGTTGCACGTCA
TGAACATCTTGGTGTTCTCCTTGTTGTAGTTGTAGTCGCAGAACCACAGCGAGTAGCCCTCCGTGTCCAGGTGCTCCCAGAACCACTTCATGGCGTCCGC
CAGGTCCTTGGTGTTCGAGTACTGCACCTTCCACGCGTCCAGGTTCATCGACGACGGCTTCTCGCGGTTCAGCACGGCCAGCGGGTGCTCCACCTTCTTG
GGCTTGGGGGCCTCCTCCTTCGGGGCGGCCTTCTCCTTCTTCGGGGCGTCCTTCTTGGCCTTCTTGCCAGAGTTGTCGCCCTCGGCGGTCAGAGCCACGT
CAATGAGAGGCACGTCGCCCACCACGGCCTGGAACTCGGGCTGGTTCACCAGCGTCGCGAACCAACGG