Description :
From Genome Similarity Track
Location :
Scaffold_71:14738- 16190
Transcript NameFunction/comments
Physo_139170hypothetical protein

Sequence
1452 bases(100 bases per row)
CCTTCAGCTGCATGAGGGACCCACAGCATCAAAGAGCCACCTCCGGTGCCAGGAAGACCCAGGAAACCAGGACGCCAGCGATCCAGATACAGCGTCCGGC
CGCCCAGCTTCTCCACAGTTGACTTCCACGTGGCTTTCCCACAGGCAGCGACGTCGATTTCGTCGATCTTGTCGCCTCCAGACATAATGTTGACCGTCAC
GTTCTTGGTGTCGGTGCTCTGGAAGTTGATGATCACCTGGCCGTCGCCCTTCTTGGTCCAGGACATGGTGCTGTTCTTGAACGCCTTCTGGATCATGTTG
AGCCCTGCCGTCGTCGATCTCGCCCATGAACTGCGTCGGGCCGCAGATGGACTGGAAGTACTCGGAGATGAAACTCGAGATGCCGCTCATGTCGAAGCCC
GTGACGACCCAGAAGTTGAGGCCCTGGTTCACCACCTTGTACACGTACTCCATGGCCTTGTAGGACGTGCCGTTGTCGATCTTGCCCGTTGTGATGAGGT
CGTTGATGACGACACCGAAGGTCTTGCGCAGCTTGTCGCGCGTGGTATAGGCCGTCTTCTCGTCGGACTGGGAGATCAGTAGCTCCATGCAGTTGCTGGT
CACCGTGGCGATGTCCGTCTTGACGATGTCCGTGTCCTGGATCTTGACGCGCAGCTCGTCCTTGGTAATGCCGGGGTTTTGCTCCCTCAAGGCCTCGACG
GTCGACCACGTGCGCTCCATGAGGCCTTGCAGGTCGTGGCCGCACGTCGAGTTGGGCCTGAGAGCGTCCTTGAGGTATCCGATCTCGCCCTTGGTGATCT
GCTCCGGCGGGGCCGTGAAGTTGGCTCCCTTCATGAAGGCCTTGAAGCGCTCCCAACTCGTAATGAGGCTGTCGTCGTGGGCCAGAACCTGGGACAGAAT
GAACTGCGAAGTGGCCATGATGCGGTCCGCCAGCCACCATTGGCGGGTTGTTTTTCCGCCCATACACAGCTTGATCGTAATAGGCAGTTCAACCACCACA
GCGTTCGACTGATAGAGCAGCACCATGATCTTGTCTTGAGACGCCTCGAGGTCCGCAGCTTTAATGGAGCGGATGTAGCGGTTAAGTGCCCGGAGCTCAC
CCACAATCATGCAGGAGCACATGACGGCGGACCGCACGCCCTTGGCCATTTCCGAGAACTTGCCGAACCAGTTGTCCATGACGCCGTTGATGCCGACGTT
GAACACGGAGCCGACCTTGTAGAGCACCTCGCGTCCGCAGTCGTCGTTCTGGCGGATGCACTCCATGCCGCACTCCACCGGGTACTCAATGGGGCATTCG
GCCCAGCACGTGTTGGTCTTCTCGTTGCGGTCGTAGTTCGAGGGGCATTTCTTCATAACGTGCGCCTCGCGCCAGCATGCGCTGTCGCCTTGGACGGAGC
GAGGTCCCACCCAGTTGCGGTACACCGGCACGACGGAGCTCTTAGCAGTGAG