Description :
From Genome Similarity Track
Location :
Scaffold_9:14737- 16049
Sequence
1312 bases(100 bases per row)
GAGTGCTGTAGTACGTACCACGCGGCTGTGTACTCGTCATCCGTTTCTGTGAGCCACTGTACCATGTGTTTGGTCCTTTGTATTTTGACTGCCAGAGCGA
TATCCATGAGTCCGAGGCCTCTCGCTTCCTTTGGAGCATAGACCAAGGCCACGTTGATTTTGTGGCGCGTTCCGGAGGTCTTCAGCGTGCTGTTCCACAA
GAAGTTTTTCTGCAGATTCACCAGCTGGGTTAGGATTGCTGGAGGCATTTTCATGTACGCTGCTGTGAATAGTACTGCCGGTAGTACTACCGTGTTGAAG
ATAATTACTTTCTCTTGGATTGTGAGTCGCATAGGTAACGCTGTTGCCAGACGTCTTTGCACTGCTTGCAACCGGAGGTTCCAATTCACTTCCTCTGTTG
GACGCACACCAATTTGGATGCCAAGGTAACGAGTGCTTTCATCTTGACGCAGTACTGGGATCCCTGCGGTCGCTTTTTGGTGTACTGCCTTGTTCAGAAA
GATGAACTTGCTCTTTTCTGGCTGTACTTGAAGGCCTGAAAGTTCCTTGTACTCGCGCAAGATCTTGAGGACCTCTGTAATTTGGTTGTGGTGTTTGATG
AAGACTGTCGAGTCGTCCACAAAAGCTGAAAAGACATGCCCATTATCCGTTTGTCCCGGCAGCTTGCACCCTTTTACCTGTAGATTGGCTCTCATTGCTA
TACTCAGGGGTTCGACCGCAAGGATGAACAGCAGAGGTGCAAGAGGGCATCCTTGCCTTATACCTGACAGCACTGGATATGCGTCTGACATTTCCCCATT
CACAAGAAACTTCACTTTCGTACCTGTGTGAAGGGTGGTGATGAGCTGGACGAACTCTGCTGCGTAGCCAAAGTTTTCCAACACTTGGAGCATGTAGTTC
CGATCGATTGAGTCGTACGCTTTTTGGAAGTCGAGCAGTAAGATTCCGGGTGAGTCATCCGCACTCTCCTTCGGGTTGAAATATGCTTGGCCCAGGTGAG
CAAGCATCATAGTGACTGACTTGCGCAATTGTCGCCCCAACACAAACCCTTGCTGTGTATATCCAATGAGTTTGTGCAGGAAGCGTTGCAGCCTAGCAGC
CAATATTGATGCAAGAATCTTGTAACTGGATTGTAAGAGCATAATCGGCCGATAGTCCATCGCGTCCGTTGAGTCATCTTTCTTCCGTAGAGGACTTACC
AGCGATTCTAGGAAGGATGGTGGAGGTTTAGCCCCTCCCAGGATGTCGTTGAAGACGTCGACAAGCACCTCTGCCATGTGCTCTGGAAAATCCTTGTAGA
AATCATTGTTCA