Description :
From Genome Similarity Track
Location :
Scaffold_79:14734- 15944
Sequence
1210 bases(100 bases per row)
CCGCGATGGTTACACCCGGGAAGTAGGCGCCACGACGCCGTCGACCAGATGCCCGCGACGACGTGGTCAAGATGTCAACTTGAAGCGAATGCAACGAGTC
ACTCTGGTCGACATGTTGAAGGGCGTCCCTTGCGACCACGGCGTGTGGCTGTATACACCACGATTCAAATGCTTGTTCACAGGATTCGTGCCAGGCAAAC
GTGGCATTGATCCGACCCGACGAGGAAAGCGCTGCCGGTGTTGGAGATGCCCAACAACTCGGCCGTTTGTCGACGGCGCGTTGGGCCACGTTGGCTCGCT
GCGTTGTGTGCGGCGATGCCGGCCGCAACGACGACAACTCGATGCCATCCAGCGAGCCGTCGGAGACTCGCTACATGGAGGGGCTGGCATCGTGCATGGA
ACGTCGCCTCAACATGATCGACGGTCTGCTTGTTGGACGCCTGCGTGATCCCAACGCCGTTTGCATCTCTCTACTCGCTTGGCTTGCGTGGGGACGAGGG
CAACCCGGCAGTGCATCCCCTGGAATTCCTTGCCGATGCCCTACGCATCATCCTGTAGCGACGGCATGTATAAAATGCCACCACGAAAGGCTGGCAGCCT
CCGCGGCACGAACCACTCGGCTCTCGCTCTCCTTGCGGCTACAAATCAAGCCATCGAGTATATACACGTGTCGTACCAGTCAGCACATGACCACACAATA
AAAGCAGGTGGCTATGGGGAATGGGCAGTGGCGCCAGAGGACGTTGCTGCCGCCTCACGAGAGAGCAGCATGACGACGTGCAGCCTATTCAAAAAGGCCA
GCGTGGGGCAACGACTCGGAGCTGTTTGGCACTACATCAGAGGACGTTGCGACCATCTCTCGAACGGGCAAAGTCCGTTCAACGTCAAACGTGTGGCGCC
TGCATCCATCATCCGCGGTGCAGTCGTGTATGTACTGTACAACACGTGAGGTTCCATGGCGCCACCGCAAAGAAGGTTGCCGCGTCAGCTCGCAACGCAC
TTGGGCCGCTTCACCCGCACAGACACAGTCGGCGTCCCCTTCTCCACACGATTTCCCGCCTCGATCAAACACGCGGGCGCTGTGGACATGGATCCTACAG
TATCGGTATCTAGTTTACCACGTACGTTCCGTCGCGATGGATGCAACGACACGCCGCCGTCTCCCGCAGAGCCGACTTGACGGCAGTGCCTGGGGCTGTT
GCGAGCACGG