Description :
From Genome Similarity Track
Location :
Scaffold_111:1473- 3315
Sequence
1842 bases(100 bases per row)
TTTGACTAATACTGCATTATTGTTGGGTCGGATTTCTCACAATGCGGTATCAGGCATAGCTTCGAAACGTGAGCGAATGCTTCGTAAACCCATTTGGCGG
TTGACTATTCGATTTATATGGCGTGCAGTAGCTACATGACTTCTCTTTTAGCTGCGTATACTCCAAGCAATAGCTTATTAAGAGAAAATTCCATATTTCC
CATATTTTGCTATTCAAAAAATGTCATATTTTCTGAAAAAGTGGGAAAATTGGCCTTTCCCGTATTTGTAGAGGTCTGGTTATTAGTAGTTGCAAAAATA
TAAAAACAGCGAACGTGCTCACATGAAATTTATGCACTCGAAAGTCTGAGCACATGATTGAAGTACGGAAGTCGGCGAGATGTAGTCGAAGCTACGGGCG
ATCCGGGTTGGGAGATTCAGCGTTAAATTACCGCCTCAAGTTGTTCTCATCCACCGTGCATGTTAATTCTTTGCTGTCTGGAAACCTGAATCATGCCATA
GCGCTTGCTTGAGTGAACATGCAGTGGTTGAGCCACATACGATTTTTTCTTTTCGAGAACGCTCAGTTATCTTGCGCCGTCCGTACATAATTTATTTTTA
TCGGGAACAAAACGAATATTCTAGGTTCATAGATTTCTCTATGAACCTAGTTTCAAGATGATTGTATATTTATAAATGCAATCCTTTTTAAACCTGGCAA
AAGGCTGCCTTGGACATCGCCAGTAACAATGCCAAGATTCGTTTGTTGATCTCTTTATTGAACCACTGGTGAGTACCGAAGTACAGCAAGCGTTCTTCAC
CAGATGAAACAATTGGCGGGAACCCGGGTACCCATCGGGACCCCGGTTCCCCCAAAACTACCGGTACCCATATATGATCGAATGTATTGAAGAGTTGGTC
TACGACCTGCGTTGAACGTAGCTTAAGCTCGGAAGAGAAACGGAAGGTGAATTCGTCTCCGCTCTCGTCCTGTGTCTCTCCATGAAAATCCAAACGCTTG
CCTGGTACGGCGGTAGAGTGCTTTCCGGTCATATGGCTAACCTCCTGCTCATGTAAGGTGGACTTGGGCATGGTAAGGTACGTTATTCGGGCCTATTCAG
TACTGGTGACAGATTTGCGGGTAGTTTTTCGTCGACAGCACCTGGGTTGATGGTTTGACTTGCCCCAACGCTACCAATATGGGGGCCAAAACTTAAATAA
ATAATTCGCGATTTGGTCGGTATCATTTGCGGGAACCCGGGTTCCCGCCAATTGTTTCAGATGAACAGCTACCGACTGAACGTCATATCAGCTAATCTAT
ATATATATTAATACCTATACTTAGTACCTACTTAGAGAAGTATATTCTAATATGTAAAAAAATTACCTTATCTCAGTCGGAGACGCAGTCGCGTAGTCGA
AGTTTTACCAGTACTTAGTACTGAGTACGAGCCATAGTGGGAATCATTTGTTGCAAAAGCACTCATTTAACTAAATGAGCGATTTCGGGTCAAGACGGAA
AATACGGGGGAAAAATCGGAAATTCACGTACTGGTAGGGGTCTGGTAATAACTACACCTTTGCCAATCCAAGTTGGCAGCAGTGTCGTTGTTACAATAGC
ATCCACGACTGTGAACAACCCGCAACAAACACTTTGGGCAAATTTTCTTTTTTTTTCTTTGTTAAATGATGCTTCCTATTAGTTAGTATGCTCACAACCG
CACATATAATATATTACTTCGAAGTACGTCGATAACGGTTTCTCCGGCAGGTCGATCCGTATTGTGCTCTCCACCTGTTTCGTCCGGCTGGCGATGTCGA
ACTCGCCAACTTTCCTTAAAACCTTAAAACCTTTGGGCAATT