Description :
From Genome Similarity Track
Location :
Scaffold_193:1473- 2542
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_193-fgenesh-gene-0.0Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_193-fgenesh-gene-0.1Transmembrane protein

Sequence
1069 bases(100 bases per row)
GCGCCCAAAGAAGCGCCGCCCGTTCCAGCGAGATCTGAAGATGGGTgAGTTCATCGAAGATAACCGGGAAGAGGGCTTTACTTCCGACTCGTCCACAGCG
TCCGATGCAACCTCTGGTACGAAGGGAAaGAaGAaGGgCgACAACGTtGACGACGCCAGCGCcGTGGgACTCCTCCTTGATTTCTTTTACAAGGCCAGCA
AGAACGAGAACGACAGCAGTGACTCGTCCACAGCGAAGCCGACCGCCTTCCCGAAGCGAGAAGTGTCCACGGCGACAAGCGCCGCGTCCTCCGAGCCAGA
GCCGGAAGTCGATGACGAACCAGCATACAAGGCGATCAACGAAGAATTGGCCAACTCGCCTACGAAGCGCATGCGCACACTGTCTATCAGCCAGTGCCAC
ACGGACGTGACGTCCCCAAAGCGATCGCGTGTCGGATCATTCACGGCTGTGACGTCAAATCCATAGAGTCTGGATCTACGATACTACAATACTACAAGAT
GACAGCGTACTAGTACGATATAATGGGAGCGCGAAGTAGAGCGACCACCCCcTCCATTGACATATGAACGCAGACTGCTTATAAACCCATTCATGTGCAT
GTCCCACCTGCTGTCcTCcGTCGTGCGCCCGCCATCTTCAACGTTCAACATGGCGCTTCCATGTTGTTCCTCACGTTCCTCCCTTCGTTTCCTCATGTCG
CACGAAGGTTGCGCGAAGGTCGTTTCTCCCCGACACTTCAACTACCGACCGTTCACGCCGACGTCAGTCAGGAAGATCGCCCCGAAGCCGCCCCTTCACG
CACCATGGAAGACGAGTTGCGCGTCTCGCTGCTGGCGGGTGAACAGCCGTCTTCAGTCActATCGgCATGCCACCGCCGCCCACGACGTCACGCTCAGCG
CGTGTGCGTGATTTCCTCATCAAAGGCAAGCGCGAATCGCATGATCTGCCCACGTGGATGTACCCTGCCGAGCAGGGAGAGACGAAGGAGCTGCGTGTGC
CACCCGacGAGCTGTATCTGATCCGTGGCACGCGTGATGCCCCCAAACACCGCCTTGGAGAATGGCCGT