Description :
From Genome Similarity Track
Location :
contig_118:14726- 16023
Transcript NameFunction/comments
g13853.t1POM75848.1 Taurine dioxygenase [Phytophthora palmivora var. palmivora

Sequence
1297 bases(100 bases per row)
TCACTTTTCAACTTGCACTCAAGCGCCATGGCCCCCATCAACATCGACTCCACCTCCACCACTGCCGGACCCACTGCCGCGGTGGTAGTCACACCAATCA
AGAACGCGCTCAACCAAGAGGTCGAACATGCACCCTTCACCCACCCGGAGCTGCTCGGAGAGTTCCCCACCAAGACGTACGATCCGATCCCCGTGCTGCC
GTACAACGACCGCGCGCTCAAGGCCGATCCGTCGTTCAAGAACCTGCTCGCGGATGCGACGGTGACGCACCTGGAGCCGAAGATTGGCACGGAGATCTCG
GGTCTGCAGCTGCACGAGCTGACGGACGCGCAGAAGGACGAGCTGGCGCTGCTGGTGGCGCAGCGCGGCGTGGTGTTCTTCCGCGAGCAGGAGATCTCGA
TCGAGCAGCAGTTGGATCTGGGTCGCTACTACGGTCCTCTGCACGTGCACCAGACGGTGGCTCACGCGAAGAGTATCCCGCAGGTGCACGTGGTGGAGAA
CTCACTCGAAGTTAGCGAGAAGCGTATCAAGTCGCAACTGTATGATCATGTGAATGTGTGGCACAGTGATGTGTCCTATGAGCGCCAGGTGAAGAAGTTT
GGGGGGGGGGGTATGTTCTGTACATGTTTAGTATATTAACTTGTGTGACTTGTAGCCTCCATCCTACACGAGTTTCAAGGTCTTGACTACACCACCCACG
GGTGGAGACACGCTGTGGGCGTCTGCGTACGAGGCGTATGACCGACTCACCCCACACTTCCAGAAATTTGTGGAGGGTCTCACCGCTATCCACAGCAGCA
AGGTACGAGATGCTCTTTGACACGTATGCAAATGTCTTTGGATGGAGCCTCATTCTTTGCATGTGAACTGATACAGAGCCAAGCCGAGAGCGCAATCGCC
AAAGGTCAGACCCTTCGCCGCCCTATCGTGGAGTTCGAACACCCGGTTGTTCGCACGCACCCGGTGACGGGCCGCAAGGCATTATACGTGAACAGCCAGT
TCACGACTCGCATCAACAACTTGTCTGCTCCCGAGTCCGGTACGTTCAGTGCGTCGTGTTCATGATATCGATGCCAGTGTGCTGATAGCTCTGTGTTGGT
CCTTCAGACGCGGTCTTGCGTTTTCTGCTCCAGCACATCGCACAGGGACAAGAATTTCAAGTGCGTTACCACTGGACTAAGGACTCCGTGGCCATTTGGG
ACAACCGAGCCACGATCCACTACGCCACGTACGACTACCTGCCCGGCAACCGCCACGCTGTGCGTGTGACGCCTCATGGCGAGATCCCGTACTTCGA