Description :
From Genome Similarity Track
Location :
Scaffold_5:147240- 149250
Sequence
2010 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGGCTGATCCCATGTATCGGAACGTGTAGGGTCCTCAGCCCAT
TTGTTGGGGAACCAGGGATATCTGTCTCCTCTGACGTGTTTAAATGCTGGAATCCAGTGAGCACTTAACCCACCGCGGGTAGCTCGCGCTCCTATATGCC
ATGGAGCGCACTATTTAGCGCCTCACACCAGCGCCTCCATGAGAAGTACAAATTGTGACCTAAGGCGTTCACTTCGATGATGCAATGGTCGTATCATGTT
CGAATGAACCATCCGGACGCGGTACAAAGTCAATTTCGTTTATTTGCCGCTACCGACATTGCTACGAAAGCTTAACAAATTGGACGTGCCAACGGTGTGT
TGACTTGTACTACGTGCGAAAAAAAGTTCGGTGATCTGTCTGATGTGCACCGTCATCGTGAGAATAATTTTCCCTTGTAACGATATACGAGTCGTGCGAT
CGCCCGTCGTACATCCAAAGTTAGGAACATTAGCGTTTTCGGCCACTTGTCTTGGAAACAAGGATATGCATTGACACTTGACGTGTTGAAAGCTGGGATT
ATTTTAGCACTAACCCATACAAATACCGGCGCCATATTACGCATTGATGGAGTAATTGTTGCTTACAAGGGTGAGTCCAGTGTTAGGAACGTTAGCGTAT
TCAGCCACTTATCTCGGAAACAAGGATATGCATTGACACTTGACGTGTTCAAAGCTGGGATTCAGTGAGAGCTAACCCACAGCGGTAGCTGCGACTCACT
ATGCATTGATGGCGTAATTAGCGCTTACAGCAGTGCGTCCATGAGATAGTACAAATTGTGACCTAAGGCGCTCACTTCGATGATGCAATGGTCGTATCAT
GTTCGAATGAACCATCCGGACGCGGTACAAAGTCAATTTCGTTTATTTGCCGCTACCGACATTGCTACGAAAGCTAAACAAATTGGACGTGCCAACGGTG
TGTTGACTTGTACTACGTGCGAAAAAAAGTTCGGTGATCCGTCTGATGTGCACCGTCATCGTGAGAATGATTTCCCTCTGTTACGGATACGAGTCGTGCG
ATTGCCCGTCGTACATCCAGTGTTAGGAACGTTAGCGTATTCAGCCACTCGTCTCGGAAACAAGGATATGCATTGACACTTGACGTGTTGAAAGCTGGGA
TTATTTTAGCACTAACCCATACAAATACCGGCGCCATATTACGCATTGATGGATCAGTCGTCCTATTGCGAGCTTCCTCAACACTATAGTGTAAGCAAGT
AACGGAGTAAATACCTGGCCCGTTACACTGGTCGTCCAGCCCGATCGTGAAGGCAACAGTAGGCGAGCGCGACTCCTCCGGCAACACTCTGGATCCTTTT
GTTGCTGGCGGAAACTTCGTTCCAAGAGATATTGCAGAAACTTTGGGAGCAGTTCAGCCCTCAAGTTAAAGGCAGGGCAGTGAAAACCGACGGGACTTGG
ACCATTGAGC