Description :
From Genome Similarity Track
Location :
Scaffold_70:147231- 148641
Sequence
1410 bases(100 bases per row)
TTGTGGCTCACAGATTCTCGTTTCTTGTAGTCGCCGCGACCTTCCAACTTTACCTCCAGGGCTTGGAGCCGTTCTTCTTGACGCCGTCCCGCCTGAATAA
AACCTTGAATGAGGGCTGCCTGGTGACGAATGAGGCTTTTTTCGGTGGTCTCAGACGTCGATGTTGAGTGTTGTTGCAGCCTCTCGGGCAATTGTTGGAT
CGTTGGTGCTGTCGTCAAGTGCGATGACCACGCCAGCAGGTCAATTTCGGAGCAACCCGCAAGCCGCATGCACGCTTCCAGGCGAATTACAGCAGGTCCA
TGTGTATTGAGCTCCTTCAAACGGGGGTAGTGGCGAAACAGGTAAGCCGTCAGTGTGTCCACCACACGTCGGTTGAAGTTGAGTGTAGGTCCATCGAGGC
CAGAACACGCTGCAAAAAGGTGGGTTTGGACATCTCGAATACGATCTCGACTTTGGGCGTCGAAAATATCCAGGGAAAGAAGAGGGACAGGTTGGGATGT
CGTCCGACCGCTGAGGTGCTTAGCGACCTTGTGATCTTCACTTGACGTGTTGAATATGTGGTTGAAGCCCTTGTTGGTGGCCGAAATATTCCACGCCCCA
CGATCGAAGATCCACCTAGCCGTCAAGTGCTCCGAGCCACTGGCATGCTGTGTCCCCCCGCGACGAAAGGAATGCGACTACAGCTTCTCCTCAACGCCGG
AGGGTCCGCCGATTCGTCCAAGAATTCGATTGATGTTGCTGTGAATAGTTGGTGAGCCTTTGGTCGTTGACTCTTCCTTGTCGAACTCAATAACGCCAGG
ATCACGTACAACATCGATCAATGCAGTTGTTGGGCCAAGACTCGAAGCTGAGGATGAAGATTAAGTTGGTAAGTTGTCGATGACGTTTGCGCATGGCCGG
CCTTGGTAAATGGTTGCCAACGCCATCGCCAGCAACGGAAGACATTATCCGGGAATATGGACAGTCCCTGTTCCTCGCTAGTCTTAACACGTACGAAGCG
TAGGAAAAACACACCGCCAGCATCAATGGACACGTTGTTCTTCCGCACCATTGCCAAGTCGGATGCCCGTCCATGCAGATACCACAACAAGGCCAACAGG
GATGCGTCTTGATAGTCGCTGCATGAGGACGCGCTCTTATAGATATACATAAGCAATCGCTTTAAGTAATCCTTGGAGCACGCAGCTTCCTGGTTCACTA
CCGCTCCGCCGTCTTTCTTGGCGCAAAAGTTCTCTAGTATCTTGCCCACTCGGAGTAGCTTGGAGCCGCCAACAGGCTGTAGGTGGGGGAGCTCGTCGAG
TAGGCTCATCTTCGCTTGTCGGAAGTACTGGATGCATGAGTTCTTGGATAGCGGCATCCCGGGTGACTTTTCACATGCAGCAAGGTACGTAGAAAACTTC
TCCATGACAG