Description :
From Genome Similarity Track
Location :
Scaffold_206:14719- 15762
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_206-fgenesh-gene-0.10Mitochondrial acidic matrix protein

Sequence
1043 bases(100 bases per row)
GCACGCGCTCGATCGTGAGGTTGCTGCTGGCAACGCACTCGAACTGCAGGCCCTGGTTGTCGCGCGTGATCTCGGCGACGAGGCGGACGCCTGGAAGCTC
ATCCTCGCCCTCCTCGTCATCCTCTTCCGCATCGTCGTACTCGACCTGCTCACCTTCTTCCTCGTCCTCGTCCATGTAGTCTTCCTCGAGCTCCATCGTG
TCCTGCGCATCGAACTTGACGCGCACCTTGTCGCCATTGACCTCACCCTCGAGCACGACTTCCATGTTACCAGGGATCTCCTCGACCGAGAACACCTTGG
CGATCTTGTCATGAAGCTCCTCGAGCTCCTCACCTTCAAAGCAGTTGCCCTTCTCCTCTTCAATCTCACGCTGTACACATCCACATCCCCATCAGCATGA
CCAATCCACGgCCCGATCTAAGGAGTAGTAGTAGTGTTGTCTCACCTTCAAGATCGACACGAGCGAGCTCTTCTCACGCGCCTGCAGCGCATGGCAGACC
ACTGGCGCGACGAGGCGTtGGCGCGTAACAGCGGACGCAGGGCGCGCACGCAGCGCAGACGAGAGAGCGgcGGAGGCAACGCGACGGAACATATTCCACG
AGGAGCTACGGCGAAAATGGAGAATGATGATCTGCAGTGTGTGTGTGTGGGTGGTgTGGGGAGTCGACTTGAAGAGCCGAGCCACGCGATCTATGCGATA
TGATtGGCTACAAACGTGATcTtGCAAATTGATTTCAGCCAATCgAAAAaCGGTATGGGAAGTTCGAGAAGGTGTTGCGCGATGAAAAACCTTGGAAACG
AGGTGGAACGGGTGTatGGATCGTGGCGCCAATGTCGGGAAACATGGAAATGGCACTGAAATGGGCTGGATATGTGTGAGCTTAGGAGAGGCAAAGGGGA
GAACGAGGACGAGAAaCTCGACaGgTGAGACCACCcGCTCGACGCGCCATTACGAGTCGTTGCCGCAgTCGTTGCGCTGAGCATCGCAACGTGCGTCGCG
GCCTGTCGATAGAATGGCAGGACGATGGCGTGACATGatAGCA