Description :
From Genome Similarity Track
Location :
Scaffold_349:14714- 20380
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_349-snap-gene-0.8U11/U12 small nuclear ribonucleoprotein 35 kDa protein
Pytar_ATCC12531maker-par_contig_349-snap-gene-0.9Histone acetyltransferase

Sequence
5666 bases(100 bases per row)
GCCGTCGCCGCGCCCTCGACCAAATCGCCGCGCGTGCTGGTACGCGCAACACTACGACCCTATCCAAGCCGGTAGTATCGACGGCACGGACACCACTCCC
CATGATAAGGCACTCACGCGTGCGCTAGAGAGCAACTTTGACGCGTCGCGCGACCCACAGATCGTTGGTGATCCGTACATAACGCTGTTCGTTGCGCGCC
TCAACTTTGCCACGAGCGAGGAGACGCTGCGCGATGTGTTCAGTGCGTACGGCCGCGTCCAGCGGATCCGCCTTGTGCGCGACGTGGTCACGCAGCAGTC
CAAAGGCTACGCGTTCATTGAGTTTGCAGACGACCGCGCATTCCGCACCGCGTACCAGCGCGCGCACCGCACCGAGATCGACGGCCGCGTCGTGCTGGTC
GACTACGAGCGCAGTCGCGTCATGCACGGCTGGAAGCCGCGGCGACTGGGCGGTGGCCTCGGTGGCAGGAAAGAGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAACGCATGCAGCAGACGTGGCCATGTGAAGATCCGACGGATCAATGCCGCCGTGGC
TCTTGGGGAGCGGCACACTCGGACAACCTTCGCCTGGGCGGGTGATTGATGCCTTTCAAAAACCCAAACTGAACAGATGCTGCACCTTCACGCAACATGT
TCAGAGCAAATTGTTTCGTATATACATTGTAACTCTCTGTCTGTTCCGGGTAATAAACGATACTTTGTGTCTATAGCCAGTTCCAAAGGGAGTATGCTCA
GTCTAGAATGTTTCAGTTTTGTAATAAGTTTCCACGGCCTCCACCTATTTTCCGTTTTCGGGTGGGTTGTTCTTCTCAGCTCTCTCTGCTCACTTTTGGC
GACGCGCACACTCGCTCAAAAGCGACGCACTGAGGCAAGGGGGCGTGTTGCACGAAGCGAGTCACTTGGTTTCACTATAGTGCCTTCGCGCAACTTGCAC
TTCCTCCCCCGCCGACAGACACACAGTCTGCACTCACTGTGACTATCCGGGCCAACATCCCAATTTCCCTGACGAAGCCCAAGCGCGCGTCGCGTCGGCG
GACCATTCCTGCGCCCCCCACGGCCGACCCACGCGCTCCAAACGCATCGATCTCATCCTCCGAGACTCGCTCTCGCGACGTGGCCGGTTTCTACGTCTCC
AAGCCCGCTCTAGAAGCCGAGATCACGCCCCGAATAGGCCCTCGTCGGACCACATTCTCGCGGGGCTTTTTCGGCGTTCTATTCAGACACAACTCTAAAC
GGTGTGTTCGCCATGCGTTGGAGGGGGGGAATACATAAAGGGGGAGTAAACTAATCCGGGACCTTGTGACTTTGAATGACTAGGTTCGTGACGTGGCCCG
CGTGACAGCCATGGACTCCGAGCCGTTTGTTGGCGACTTTGGACTCGGCATGCCGCTCGATAACCGGTATATGAACCTCGGCGGCATGGGCGCCATGGCC
GGCAGCGGCGGCGCAAACGATCTCATGAACCCAGCCGGTCTCGACTTTAGCAACTCGATGATGATGATGGAGTCGAACGTGTCGATGGTCGGTCCGCCCG
GGTCGTCGACCGGCATGATCGACTTTCCCGACGAACTCAACTCGCCCAAGAACGCAAGTAGCACGGCTAACTTGAGTGGCGTGACGACGAACGCGAGTAT
GAGCGTGTCGTCAGACGCAGGAGCGCTCGGCGGCGACGGAGCCATTCCATTTCCCGCGGCGCTCGCGAACGACACGCCGCTGACGATGAACCCGACGGCC
ACCAACCCAACAGCAGCGCAGGTCCAAGCGGTCCAAAACCAGAACCGCACGGCGGCCATGAACGGTGGCAGTGCGGCCATGAACTTCTCGGGCATGGACA
TGAATGCGAGCGCGATGAACGTCAATATGAACCCAGCGATGAATGGTGGTGCCGTCAATATGACGATGCCCATGAACATGGGGATGACGCCCGGGTACAT
GCCCGACATGAATATGGGTTTTGCGATGAACCCCATGTTTATGAACGGCGGCAGCACGTACAATCCCATGGCGGGTGTGCAACCGCAGCAAATGAACGGC
ATGATGGTCAACATGGGCAACGGCCAAATGTACTTTCAGCCGCAGCAGCAGCAACAAGAATATCTTCGCATGCTTCAGCAGCAGCGGCAATCGCAGCTAC
AGTTTGCTACCATGCAGCAACAGCAGCAACTGGCCAAGGCCCAGCAAGCGCAGCAGGCTCAAGTACAACAGCAGCAGGTTGCAGGGCAGCAAAACAACGC
GGCGGCCGTCGCGCAGCAATTGCAACGACAGCAAATGCAGGCGCTGCAGCAGCAAATGGCAATGCAGCAGCAGCAGCAAGCTCAGGCCAATGGTGTTCAG
GCAACGGGTCCAGTTGCGACTGCACAGCAGCTACAGCAGCAGCAGCGAGCGGCGGCACAGCAGCAAGGCCAAGCGACGGCGGTGGCCGCTGGCACGCAGA
GGCAGTTCCAGGCGACGCCCGGTCAGCCCCAGCAACAGCAGCAGCAGCAACCAACGATGCCTGCGGCACTCGCTCCCAACACGTCGTCGACGGGTGTCCG
TCAGCCGTGGCACTCGCCCGCGGACCACGCGCTGCGCCGCGAAATGTCGAACCACATTATGCGTGTGCTCCAAAGTCAAAAGTCGAACGCACCCGCCAAT
TGGCTCCAGCGGTTGCCCGAGATGGCGCGGCGGTTGGAAGACGAGTGCTATCGGATCTCAACGTCGCGCGAAGAGTACGCCAACACGAGTACGCTGCAGA
GCCGGTTGAAAAATATCGTTCGTGCGGCGCAGTCACAGCAGCGTGGTCGTGTCTCAACGCCCAGTGGCCCCATGAGTCAGGCACCATCCATGACGACGAC
AGCGACCAGTGTGGCGACGACTGCGGCGCGTCCGGCTTCTGGATCCTCGCCAGCGTTGAAGCCCATGCCGATCCCGTTCCCAGGTGCCGAGGCCGTCAAG
TCGGCGACCGCGACACCCATCAAGCAGCAGCCGAATATGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCAGCAGCCGAATATGGAGGCAG
CACAGCCGCTTCAGATGCCAGCGGAGTTGCAAGGACCTGGGCCCAGTACGGCGATCAAGATGGAGACTGCGCAGGCAATTCCAATGCCGCTTGAGCTGCA
GAACCCCGCGACCACACCTGCTACTGCATCAGCATCAACAGCCCAAGCGACGGCTCAAGCCAACGCCAAACAAGCCATGTTTGATGCCGCCGCAGCCAGT
AATGCTGCTGCTGTGGCTGCGGCCAGCCAGAGTCGCTCCGCACAGTTTCTGCGGCAGTTCAAAGCGCGTGCACAGCACGTGACGTCGTCCTTGGAAGAAG
AACAGAAGCGTGAGTACCACAACAAGCTCCAGTCGATGACCACAAGCGACGTGATGAATGCCAACTCGAAAGGTGTGCTCCAGCGACAGCAGCAACGACT
GCTATTACTGCGCCACGCAATGAGCTGTAAAGCCCCGGAGGGGACTTGCCTCGCAACGCCGAGCTGTGGTGAAATGAAGCGCCTGTGGCAGCACATGGGC
AACTGTAAGGAGACCACGCCGTGTGCGTATTCGCACTGTATCTCGTCCAAGTATGTGCTGTCCCACTTCCAGCAGTGCGAGAATATGAGATGCTTAGTGT
GTCAATTGCTGCGGTATCCCGTTGAAGTCAAGGAGAAGAACGGCGCGTTGATTATGGATACCGACCGTGCGCTCCAGCAAATCCAGGCTGCGACCGAGCG
GCGGTTGGCTCACCAAGGGCATTCGCTCGACCCAGCGACCAACTCCACCGTTCCCACAGCACCAACGGCTTCCACAGCGGTTGACCCGGCGCGACAGCAG
CAGCAACAACTTGGGTCCGCGAATCCGTTCCAACATGCCCCCAGTGCCACATCAGGTCAGCCGCAGATGCAGCAGCAGCAGCCTGTGGCGCCACCGCCAG
TGACCTCGCAGCCGATCCAAACTGCCGTACAGCAGACGGCGATGAACGGTCGCCCGACGATGAGTATGCCGCAGTCTACGAGCCAACCAGTTGCCACCGC
GACTGTGGTGCCTACGTCCCAAACGAAGGCCGCGGAGACCAATGTGCCTGGTCTGACCGAGGAGGAGAACCGGCAACTCGCTCTCATTCAGCAACGGCTC
GGAGGCGTGAGTTTGGAGCAGCTCACGCTAAACTCGAAAAAGCTCGAGAACTACGCTGAGCAAGTACGCACCCAAGTGAATGCGATTATGAACGAGTGTC
GGCAGCTCATGCAGATGCGGAATAGCACGCAAGACCCGGCGATGCAAACCCAATTTGATGCCCAAGTACAGGCCAAGAAAGTCACGCTTCAAGATCTCCA
TCAAAAGTACAAAAAGTGTACGAGCCAGCACCGCATTGTCAAGCACGTGATCAGTGCACGGATGAGTGGCGCCCCGATTGGAGGGGTCGCATCAGCAGCC
ACCGTTCCTCCTGCTAGTCAGCCTTCTCAACCTGCCTCAACGGTTCCGACTTCGACGACTATGACCAATGGCCATTCCCAGTTTCCACTCAACATGCAAC
CGCTGTCGATGCCACCCGGACTGGAGACCCCGCAGGCGCCGATGTCTCAGCCGGCGCCACAAACTCGACCCCAGGTGCCGGCGCAGACCTCTATGCAAGG
CGCCGTGCAGCAGTCGTTCTCAGCGCAGCTCCAGCAAGCGCAAGGATCGCTGGTGCAATCTCATGCCCCCGTGACATCACAAGGACCTGCGCAATCGCAG
CAGCAGCGAGGTGGCGGGGGTGTGACGAGCCAAGCAGCCAACGATATTCTCGGCCAGAGTTTGGGGATGCCTTTGGGCAGCAACGATGTGCCAATGCCGA
TGCCAATGGGACTCGCGGCGGCGGGCAAGCCACTGGACATGCCGAGCGAGTTGAGTATGACGAGTAAGCCTCTGGCGATGCCCGAGAATCTTCAGTCGGG
TCCGATGCGTGCGGCTCAATCAGCACCTACCCCAGTACCTGCGGCCGCCGCCAACCCCAAGAAGTCAGAGCCAACCGTGAATCCGTTGACGATGAACAAC
TCGAAGTTGAATGCGATGATGGTGGAGCACCAACGCATGGACGCCGCAAAGGTCAAGTTGGAGCCGGCTGCTGTGACTGTGACGCCAAGTGCGACGACTG
CGATCGTATCGGCAACGTCGACTGCTGCCGCGTCGTCGTCTGGCGCACCGGCCGCGTCGGGCGATGTCCCGACATCAATGCTGAATGAATTGACCAACGA
AGAGCTCAAGGCCCACATTGACTCGCTTATCATTGGGTACAACGCGACGATGCAGCCGCTCACACTGAAGAAGCGATTGGAGGGTTTGTTGAAAGGCATG
ATGGACCACAAGTTCGGCTGGGTGTTTAGCAGTCCCGTGGACCCAGTCGCGCTGGGCATTCCGGATTATTTCAAGATTATCCGTCGCCCCATGGATTTGG
GCACGGTGAAAAAGAAGCTGGATGCTGGTGTGTACAAGCATACGGATCAGTTTGCCCATGATGTGCGCACGACATTTGAGAATGCCAAGACGTTTAATCG
CGAAGACCAGGACGTCTACAATCTCGCCAAGGACATGTTGAACGATTTCAATGCTGAGATGCGGAA