Description :
From Genome Similarity Track
Location :
Scaffold_946:1471- 3079
Transcript NameFunction/comments
Phypl_g11772hypothetical protein PHYSODRAFT_360745

Sequence
1608 bases(100 bases per row)
TTTTTCTTAAATATGCTGCTTCGTTAAAGAAAACACGCGCCGCGGTGCGACACTCCGCGTGACTTGAGTTCACTGAACCTCGCCTGAGCAAGCAAAAAAC
CGAGCGTCCACAGCCGGGCCACCGCTCTGTGATTGGTCCAAATCGTATATTTAATACCGAGCAATCGGTAAAAAACGCGCGAGCCAGCAAACAAGCGCGA
TCTTTTCGCCTCTCAGTTCGCATTTTGCCTGCTTCCCCCAAGTCGCTCTTCCAATCAACCACCCACCAGCACCGCTGCAATGGCTGCCAAGTACCAGATC
GTGCTGATCCGCCACGGCGAAAGCCAGTGGAACGTGGACAACAAGTTCACGGGCTGgcacgacgtgcagctgTCCGCCAAGGGCGAGCACGAGTCGCACG
ACGCCGGcaaggtgctcaaggcgGCCGGCTTCAAGTTCGACCTGGCCTACACGTCCGTGCTCAAGCGCGCCATCAAGACGCTGTGGAACATCCTGGAGGA
GACGGACCTCATGTGGATCCCCGTGATCCGCTCGTGGCGCCTCAACGAGCGCCACTACGGCTCCCTCACGGGCCTCAACAAGCAGGAGACCGTGGACCAG
CACGGCATCGAGAAGGTCATGATCTGGCGCCGTAGCTACGCCAccccgccgccgtcgctcgaggccgacAGCGAGTACTACCCGGGCAACGACCCCAAGT
ACGCCGACGtgcccaaggagctgctgcccttcgccgagtcgctggccaccacgggcgagcgcgtgctgccctACTGGGAGCAGACCATCATCCCGACCAT
CAAGgagggcaagaagatcgtGATCGCCGCCCACGGCAACTCGCTCCGAGCCCTGGTCAAGCACCTGGACAACATCCCGGAGGACACGATCACGGGGCTC
AACATCCCCACGGGCGTGCCCCTTGTGTACGACCTGGACGAGAACTTCAAGCCGGTGCCCCACAAGGACGCCATCGCCCCCCTCTCCGGCTACTACGTGG
GCAACcaggaggagatcaaggcgcGCATTGCTGGCGTCGCCAACCAGACCAAGGCCAAGTAAACGCTCGATTGCGAGTGCTGCCTCTAGGTTTTCCCGTG
CGTCTGGCAGTGTGTTGCCTCAGGTGGGCGGGGGCGAGCCGGTGCCCTCAACTTGCAGACAGAGAAGCGTCGCTGTGTAATTTCTTAACAAAACCACTTG
ACAAAAAGACCCCGTACACTGTCGTGCAATGCttgcccaagcagcagagaaGTGCAATAGTTGGCTGAAATCCGGGGTCCCTCAAGCTAACGCGAATGGA
AACTAGATGAGAGCACTGCGCTAGGATGGACCGTGCTGGCTGGACAAAAGAGGTCAATGCGAGGATTGGCGCAGGACCGATTGCTCAAAGTGCGACGGCA
GTGATCTTTGCCAGAATTCGTGCAGTGCCATGACGTCTCGTGGTCCACGAGACTGCCAGTGGGGTCGGCTGGCAGCTTCGCGTTTTCGCGAGCGTAACAC
ACCATGAAGGttgcctgctgctgctgctgctggaccgtATAAAGTCGTTTTCTAGTCGATCCGCGAGAAGCTGGGGAAAATACACGTAGCGTTATTACGG
ATATGCTG