Description :
From Genome Similarity Track
Location :
Scaffold_3244:1471- 2602
Sequence
1131 bases(100 bases per row)
CAGCCTTGACACTCTGCCCGCTGCGGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTTGGCGAAGCCTTTAAGGCAGGCGAGCTAGCCGAG
GTGGTCCTGCTGGGACCTGAGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACACCAAAAAGGCGCTGAGCGCAAGAAGTGGAT
TGGCGATCCTCAAAGATCCTTCGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCGAAAGACCCACCGACGGGCCTGCCTCTGGATCG
AGGCGTGTGTCATGAGATTGACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTACAGAGAGAGCAGTGTGACGTCATTGACGCATTT
CTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGTGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATT
GTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGTTGT
ACAGCGCGCTCGACTTGTCGATGGTTACTACCAATTGCTCATGAGAGCGAGCGACATTTCCGCTGAACAGGCGGTGAGTACTCCGGACGCGATATGCTCT
GGAGAGTGGCTGGTCCATGCCCCCAGGGAGCTGTCGAAACGCCACCAGCAACGTTTCATTCTTCTTGTGACGCCAAGTTGTTTTGGCCCCCACCCCGGAC
GTACGCCTCAGACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGAGCGGTGCT
CGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGC
TTACGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCATAGGCTTAGCCAATTACTTG
CACAAGTACAGCGCGAACTACGCGGAGATGG