Description :
From Genome Similarity Track
Location :
Scaffold_89:14707- 16801
Transcript NameFunction/comments
Phypl_g2834hypothetical protein
Phypl_g2835hypothetical protein PHYSODRAFT_489722
Phypl_g2836histone deacetylase, putative

Sequence
2094 bases(100 bases per row)
GCCACTTTGTGCTCATTGCGTGGCAAACCGATAATAACCGGTTGGTTGGCACAAGGACGTTCGTTACACGCGGCAGATCATGAGCTCGGCAGTGTCCACA
CTGCTGTCCTTCCTCTTTGTGGGGGCGCTCTGGGGCTGCACCAATCCGCTCATCAAACGAGGTGACggaaggagatgctggaaGTAGTTGGAGAGGGGGC
TGACTGGACGGTTGCTCGGTGTTGGTTGGGGTTTATGGCTGAGCAGGAAGCAATGGCGACGCCATGTACACTCGGAAGGACAACAGCGTCGGGGAGTTCG
TCCAGCAACTTGTGGGACTGGTGAAGAACTGGCAGGTGAGGGAGGAGGCTGGAGGCTTTGGCGCTGGTGGGTCCAAGTGGACTTCTGACCACCGTGTTGT
GCATTGTTGATGAAATGTTGCGTTCACTGCAGTTTGTGCTGCCATTTGCTCTGAACCAGAGTGGGTCTGTCGTCTACGTCTTCCTGCTCGGCTCGGCGGG
TAAACTACGGCTTGTTCTACGGCTAATACGACGTTCGCActgtgtgtgcgtgtgtgtgtgtctcCTCTCGTCATGAACTAATCCTTGTGCTTTCCTTCTA
CTGCCGGACAGACATCTCGAACGCCGTTCCCATCTGCAACTCGCTGACGTTCGTCTTCACGGCCATCACGAGTCGTCTGCTTGGAGAGAAACCTCAGCGC
CCTGCCTGTACGTGCCCAAGTCTCCTTCAGTAAACTGTAGCCATCCGTTGAACTGACCCACACGAAAACTCTCTACTATTTGGTATCTTTACCATCCATT
CGCCATCGCCACTCGCACGTTTTGCAGCCACTTACACCGGCATGGTGCTCATTCTCCTCGGTGTAGCTATTTGCTTCAACAGCAAGCAGGACATGTCGTC
GGTGTAGTGATGGCTACACATGTTGCCGTCAATTAGTAACGGCGCGTCGCGTGCCTTACAAACAGCCATACAAAAAAATCGGTGGCCGCACCACTCCACC
AATACAGCACTTTACTTGGCCATGGGCAGTTCCtcagacgaagacgatggcgactACGTGCCCGAAGGTGCGTCTAGTCACCTCCCAGTCACAAACAATG
CACCACCCTACAACGATTAACCTTCACTATGCTCCGTAGccggcgaggacgaggacgacgacgccctggacgccgacgatgtCTCAATAGACCAGCAGCG
AAGCGTCACGACGGACTCGCACGTGGACCAGCTCTGGGACGACATCAACGCGTCCACTGCCGTCtccaggaaggcggcggacAGGACGTCGAGGCTGTTG
AGTGggctgaccaagaagacgaagcgcagagctgacaagaagaagaagcggaagctgcacgagttcTCGATGCCCGTTCTGAGTGTGGACGTGAAGAAGT
CGAGGAAAGACATGGCGGGGGCTGCAACGGCGGCCAGGCTCAAGGTGGACCGTGTGGTCAAGTTCGCTGGAAAGGAGTACAGCGTGTCGACGAGTGCTGA
GGTGAAAGGAGGAGGGAAGAAGGGTCTGGATCAAAtgctggagtcgctggacgaaCCGAAGAAGGTGTCAacgatggagaagacgtcgctggactgggac
aagttcaaggagaaggagggcaTTGAAGAGGAGCTCACGCAGTACACGAaggatggctacattgaGAAGCAGGAGTTCTTGCAGCGCCTGGAtctcaagc
gcttcgagatcgagaaggccgagcgcgacAAGCAACGcaaactccagcagcagcaaccgaaATAGAGAAACAGCAGCGAAAGAACTAATCACCCAGTTGT
TCAGCTCGTCGGTATCATTGTATAAAAAGCAGAGGATATGCACAAGCGCCCCACTCGCGTTGTTGTCTAGTCCACATCCATCGGGATGACGTCCGGTGCC
GAGTTGTCctctccttcaccttgagcAGAACCGTTTGCTGCACTAGCGCTGGCATCAGCTTCGCCGTCCGCGTTTCCTCGCTGATCCTTGTCGTCTCTAT
AAAACTCAGCCTCGTGCTGCCGCTTTCCGTCGTTGTCAGCCCGCGAGTCGGGGTCCGCTgcatcttcgtcctcttcgcgTAGCATGTGTGTCGG