Description :
From Genome Similarity Track
Location :
Scaffold_84:147022- 148692
Transcript NameFunction/comments
Hyaar_Emoy2808628hypothetical protein

Sequence
1670 bases(100 bases per row)
TGTGTCTGTTTAGAGTCAGTGTACCGGGGATTGCGAGGTAATGTAGGCGTACATTCGGCCTACTGTTGCAGGACAAACATTTCTGCCATGAACACGTTCG
TTGGTACATAACAGCTCATAAGTATTACGTGTGATATGATATGATTTGCAGTCTTTGTGATCACCACATCAGAAAGGGCCAAGTTTATCATAAGGGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATGATTATGTATCGGTAGAGCTCCACTCCTA
TAAGTCGCTTATGCTCATTAGTTCTTTGCGTTAGACAAGCAAGCAAGCAATCAGGAAGTCAAGTGACTCATCGATTGTCGGGAGCCAGCAACAAGTGCCN
NNNNNNNNNGCTCCCAGTCTCATGAGAAGATTGTACAACATATCGGTGTCATAATTCCATACGTTTAATATGGTCATTGAGTATCTATACAGTCCAGGCC
GCGATACAGTGGCACGAACCCCAATTTACATACTCTCTGTCGCGCCAGGGTCAAGCTTTTGGCTGTATATCTCGAAACAGCTCTCGATAAAAACATTTTG
GGCTTACGGTAACATCTCGATACTAGGTCGAGGTCGACACCGCCATCTAGACGTTCGAGCAAGCATCAAAATGTTCGAAACCATCCGTCAAGGACTCGTC
CTCATTTCAGTAAGTGCTTGTCTGACCACTCCACGAGAATCCACGATCGTCGGTTATATTACCGCTGTAGCAATCCAGTTTTTGCTCCCGACTCAAGCGT
AGCACAATGGGCACACAATAGTGTCAATCTCCATGATTCTTTGCTGACCCGCAGGCATAATGCAGATCTCATCAAGTTCTGACAGGGTTCCGCAACCTGC
ATACTTGACGCCAGTTGCGTGTCAGGAGATTCCAGCAACGTAACGTCCGCGGCTGTGCAACGCACTTTGAATGTCCACTGTGTTCAGCCCAGAGCAAACG
ATAACAAACACCACCTCATGCGTTCAGCACCTTATCTCAGGTCGGGTGATCTCGGTTTTTGAGTGTTCTTGAAGTAGCTGGTATAGATGATGTCATCGCA
GTCTGAAGTGGCAAGCAACAGAGCGCCCATCTCACATGCCAAGCAGCTATATCGCCCGCGACTGAACGTAGTTCGTGTGAGCCTGGATTTTCTCGACCCT
CTTTTTCAAATCCGGTTGCCACATACATGTGAACAGTATTCATGTCCTTTTCAGCCCTCCGGCAAGGTGAACCTATCACTTGTTCCCCAGGTTTTCTTGA
CTTCTCTCTATTCACCATCAAGCTTCCAATATTTTGCTGTTTGCCAACAAGTCCAAGGATTCACTTCCAAGACGTCTACTGACAGAGAAGAGACCGCTTA
CTTGATGACACATGATCACCTGTCATTCCACAACCTGCCGTGCAAACCGCAAAGTCTCAAAAGCAACTGCAGCTTCGCGACTCCTGTACATTCCATCTGT
CCGCCAACAACCGTGAACCATTGCAATACGCTCATCCAATAGAAAAAATCATGAAGCACGGCGTCTGGTCCGTNNNNNNNNNNNNNNGGTCCGTAGACGA
GCACGACCGGTTCCTGTTTGCGATCAAGAACAATCCTCACGGTCCATGGGGCTGCATCGCTGCAGCTGTT