Description :
From Genome Similarity Track
Location :
Scaffold_2082:1470- 3295
Sequence
1825 bases(100 bases per row)
GATGGATCCGCTCGTGTACGACGCGGAGGAGGAGCATACAGTGCAATACTGTGGAGATTGCCCGGATGGGATGTTGTACGGGCCAGATCCACTTACGCGG
AAGGCCTCACCGTCAATGAAGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGGGACAAGATTTAAAACGGCTGGTGATTTGTGGGGATTC
AAATTTGGTAATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGTTG
AATCACGAGTTGGTACATGTCAAGCGAGATTGGAATGCCAGTGCGGATAGTTCAGCTATCGGTTGCACTAAGGTAATCAGCTGCCAGCTCCCTCGCTTTA
TCCACCCCCTACATTCTACTCGATACAAAAGTAAGTTTACAGATCTTAGCGACTCTGAGCATTTGATTGCCGATCAATCATCGCTCCTAGAAGTACTTTC
TTTGACTGAAGCAGCAAAGAAAACTGAAGAGGTCGTAATCCAAACTCTGCTACTAGGGCACATTTTCTTTCTTCAGTTTACAAGAGCTAACGCGGACGGA
GTGCTCGTCTAGTCATTACGCCGGAAATTGATGTAACCCTGAAGGAATCAGCAGCAAGGCTTCGTCACGAACAACCATCACTACAACTACAGGTCCTCAA
CCAGTAAATGGCTTCGTATAGTTAGAACCCTACCGTCCTGTACTGGTCGTTCAGCCCAAGCCGCAAGACGACCACCAGCAAAGAAACCAGCAAAACACGC
GAGAGCAGAACGGTCTTTTGACTTACGAAAATCTTCATCACGGCAACGGAAGAAACAGAGGTCGTGGCGCTCGAATCCAAGACGATCACCGTGACGATGA
TACCGCGTACAGCCACCCTATGAAAGAATTTCTCAATCTGACCTCGCAAAGACTCATACCCATGTTCCTGGTCCTGGTACTTATCTTACCAACGATCCAC
CAAGGTTGCATACAGCTTGTAGCTCGCGCCGAAATGAGCGCTGGCAGCTCGTTTCAGTTTGGCAGCTCATCCCGCCAATTGGTATCTATCAAGCGCTAAG
CTTCTCAATAAACACGCTGTGTTTTGTGCACGCCACATCCCATATCCGCTGAGGACAAACCCGCACAGGGTAGCACAGCATATGAACACGTGTCTTTCAC
AGGAGCTAAGCGGATATTTGCGTGAAAGTGCTAACTTGCTGAAGCGCAGCGTCGCCACCTACGACGAGAATACTTGGATGTGGCGCACCAATGCGAGCAG
CAAAATCGCGATTGTACTTCTCCAGCGGGTTATTAGTCCGATTTATCATGCTCACATTGTTGCGCCGCATCTGGCTCACGTTCCACAGCGACGTGTCGAA
CCTCTTTGTCCACGTTCGCACAAAATACTTCCAGAAAGCGTTCCATTTAGTCTTTGCTGCGGTCTCATCGATGATGCTTCGAACATACCGTAGTCCCTGC
CAAAAAAAATTATTTTATTTTAGTAATATTTTCCGTAAGTAAAATACAAAAATTACGTACCTTGTCCAGCACTTCTTCGGCAGGAATGACAGTAAGCACG
TCCAGTTTTCCCGACTTCATGGCGTCTGCGATCTGTTCCTTGGGAATCTTCAGTTCTACCATCTTCCTACGTAGAGCCTGCTTCCAGTGGAAGAGGCAGC
CAACAATGTTGGCTGCAGGGAACTGCTCAATCACAGCGTTAATGAGCGCAAGCTCAAAGTCACAGGTAACATCACGAGGCTCCAGCTGGCGGTCGGACGC
CATGATGAGCTGCTCTAGTACTCGC