Description :
From Genome Similarity Track
Location :
Scaffold_1426:147- 7581
Transcript NameFunction/comments
Phyag_g10592hypothetical protein
Phyag_g10593hypothetical protein

Sequence
7434 bases(100 bases per row)
cctcagacgaaagcccactcggtaaacgggctgctggggagtgaaaggcttagtgccttcattcgtcggtagcccagtccgaacgtaaagatctctcgag
accattcttagtgaatataccaggTACTCTGGACAATTATTTGGTTGTCGATTTCTCGCCAAATTCTCTAGTAGAGGGGATTAATCCTTCCTTATATAGA
GGTATTTGATAACCCGCATACAAATCAACGGATCGATGGTAGTGCTGCACCACGATGAGCTGGATCACGCGCTCTGGGGCCCGGCGTCGACTACCGGACG
CTCGCGAGCCGCCGACATGGCGATTTACACTCATCTGGTAACATTCTACGCTCTGTGTAGTGCAAATATACGGGTGGGGGACGCTAATAGCGTTAACGTG
TAGGCTGTGATTGCGTTGCTCGGCGTTAGTTGTGCTCTGGACTACGACAAACCCGAGGCAGTGcggctcgcagcagcggGGGCGACAATGTTGATGTATT
TCCGCAGCACTGCACTGGTACGATCAAGGGGGCAAAAAATACTTTTCCGAGCGTAAACTAACGCGGCGCAGTTCGTCCGCTTGGTGTTGTTTGTGTCCGC
CATCGTGTTCTACGGTGATGTTATCGTGCCGATCGCTCGTCTTGCTAAAGCTGGGGAAGTTCTTCCTCTGCCCGCTGCCAAAttggtgctgcactgcatc
tGGGTCTGGAACACGGTACGCACTTCGTCATCAACCTGTGAACTAGTACAGTCGCTAACTTTCGTTTGACAACTTTAGCTGCGCATTCTGTATGCAATCT
TCCGGTCTGGAGCGCTCACGTCAAAAGCAAAGGAGAAGCGTCCGCTGCCGGGCGCATACAGGAGGCGTCCGAAGGTTGAATAACGTTCACAaacgcaagt
tgaagttgtctaTTAGTTTTGTGGCGACCTATTGTGATGTGTCGTAcatgttgcagcaactttacCTTTTATTTGTGGCCTACTTATGGCTCTACTAGTT
GGAGACAATCACTCTCAATTCCGCatccgcagcagcactatCTTAGAGCCTGTAGTCTAGAGGACGAGATGCGGGGCGGTCTGTTCCTCTTCCCGCTGTA
CGTGGACCcagctgacgcagcagcagcagatgcacaCGAAACGCTGCATCCAGTGGCGCCAGAACCAATGACAAGCGCCGAGTCCTTCAACCCGCAACGG
TTGGCGACGCTCATCCGATCTGCAGACACGGGCAGACTCAGGTAATGATCCCATTATTTTATTTACTTATTATCAATATGATATATTAATTATTTTCTAA
TGTAACATGTTGCAATATTGTAGTTCAGCAGGTGACGCGACGGAGATCGACGCAGAAGTGATGAACGCGTTGCCTAAATGGGCACAAGCGGTAGTGCAGA
CGGGGTGCTTCAACGGTCTGTTGAGTGTTGTctagtttttttttattaaCTACAAGGCATAATGTAGTCTCAATGGTGATGAATTGTGGTGTTTAAAcag
gtggagctggctcTGGAGAGAAACGTACACGTGCGGGCAAGTTCAAGAGAagtttggagctgcagaaggaagGGAACTGTGGACGACCACGCAAAAAACG
GTCACTCAGTAgagatgaagagctgcaaaatGGCTTGGACGAGTTGAATGCAGAGTTAGCTAATGTGGAgatggaagatgaagaagagatggacgatgaa
gaagagcttccGACGTTTTCTACGCGGGCGGAGATCACTGCAGACAGTGTTGATAAATATGCAgagttgctggagacgtGGGTTGACGTGGCGACAACCC
GTCAGAACTTGGATAAGTTCGATGAGGATGAAATGGATGTATTCCAGTCAGAGGAAGTtaagatgctgctgcagtcgctgaaaaccatggagaagaacga
tTGGATTAAACTGCTGGAACTAGAATTGGTGGTCTCGTTGATGAACACATTCGATGCGCAGGTGCGACTGGGCTTAGCGGTGAATGTACTGCACAACTTG
GAGCCGAATGATGGAGAGGGGAAATTGCAGCCGTTAAAGATTTACAATCACCAGGTTTCGAGACTAGAGGCGTCGCTCGATATCGCGATTTGCGAGCTTA
TTGTTATGACAACGCCTCATATCGACCGCAAAGTTCTCGCTGAGGAGAGAATTGAGAAGTGctttgagctcctccagcacaTTATTCGTCGTTTGTTGCT
TCCATGCATCGATACCACATACGTGACGACTGCATCCACACCAGTGACTATAGAAAATAATCGGCAACACTCAACCGGAGGGAAACCATCCAGCTCCAAA
CGAGTAAACCTGCGCGCGAACAAGAGGATCCGAAAGTCGATTGAACGAGTTTCTCATATGACTTGCGAGCTTATGGATCAGATTGCCGCACTTATCTTAA
GTGTGAAGCTCGCGGACCGATGGATACTCCCTCTATCTTCTTCAATGGTGGAGCTATTCGCTTTAGAGCACAGCTCGTATGCGACGTCATTGCAGCAAAG
CGCTCTGGGTATTTTGCGAGCTGTCTTTGTGCAGTATGAACATCACAGAGACTTGATACTTGGAGACATAGTGGAGATCATGGTTAAGCTACCAATTGCC
AAGCGCACTCTTAGGACGGTGAAATTATTGAACTCAAGCGACACTGTGCAGCGTATATCAACCTTAGTGGTGTCGATAATACAGTCTTGTGCAGCTACTG
ACAAACTTGGAATGGTAGAAGATGAGGATGGTCCCGTTCCAGACTCAATTGAACCTTCGTCAACACCGGATACTGTTCCTGAAGAGAAGTCTCTAGATAA
TGATATCGCAGTGACTACACTGGGAGACATACGGAGAAGTGCAGAGGTATTTGTGCCGACGCTACTGAAGGCATGCTGGAAGAAAACGGAAGAGCGAGAC
AACCGCGTGGTCTTAGATAATTTCGTTGAAGACCTTCTTGTGATGTTTGTACGCCCAGAATGGGCAGGCGCGGAAGTCCTTCTGGAGGTGTTGAGCAATT
CATTGGCAAGTATTTTACACGCAAATATTTCTCCAGATGTGAAAACCCCGGATTCACAGCGCAGTCTAGCAGCGCTCAACTTGGTCGGTAAAATATGCGC
GTCAATTAAGCGATACCAGAGGAAAGACCAGAACGCTATGGAGGATGACACTGACGCTAccgctgttgttgaagagcACACCAGTAGTCTCCGTGTTGAT
ATCACTGGTAAAAAGGCACGGTCTAGACGAGCACCTCCAAGTTCTAGAATTGATGCGTTTCAGGACGTTGCGTTGAAGCATGTTGTTGTGGTGCACCTCC
AACGACATCATGTTGGTCAAAGCGATTCTAAGAAGCTGCTAATTTTGAAATTCTTCTTGGAGGCGAAGGCGCATTGGAGTGGGGCCGAGGTGGCTTGTCT
GGAACGAGAAAGGGAGCTGTGGAAATCATTGTGGAAATCCAGGGGTGGAACAAAGTGGTCTTTTAAGGTCGCTGTCCCTACGAGTGAGATAGCGCTGAAA
TCCAGTTTGCACCTTGCAATGAAGCGTGAATTTTGTGGCCGTTTCGACGGCTTACTTCAGCACATTATGGCTCTACTTTCCAAGGGATTGCCCACTCTAA
GAGCGCGAGTTATGAAATGCCTTCGGGGAATTGTCGATGTCGACCCAATGCTGATGGCAGAAACTGGAGTGCAATCGGCCGTCGAGATGTGTTGCTCTGA
TGAGAAGCCCTCGgttcgtgaagctgccgtcgatTTGATTGGGACTTACGTCTTGCTACAACCCCTTTTGGTACGAAATGATTTGCTGCTCAGTTAAAGA
TGTGTGATACTAATAATGCTGGCTTGCTGTGTGGACAGTTTGACAAGTACTTCAATATACTTGCCGAGAGGGTCCGAGACAAGGGCATCCAAGTTCGGAA
AAGTGTGTGCAAGATCTTCAAGATAGCGTTAGTTTCCATGCAAGACCACTCCCGTGGAACTATCACGGATCAAGAACTTCGTCGCAAGAGTGGTTGTATG
CGTTGTTTGGTTGAACGAATTGGAGAcgcagctgaagagcaagGCGTGAAAAACTTCATCACTGATACTTTTCAAGAGGTTTGGTTTGGTGCCGAACTTT
CTTCCTCTAAACTCTCCAACCCATTGAGTGAATTCGGTGACGGGAGCACTCTACCACCCGGTTGGACTGCTATCGCAAACAATGTCGATAGAAAGACTGA
TGCGGGTTCAAATTCCAATGGAGGAGGTACAAAGTTTGTTTCCAACGATGGGAGTGTCGCCAACTCGGTCGAAGAAGCGTGGTCATCATATCGAACTCCA
ACGGTGACGCCAGCCAGCGTAGCAAAAAATATTGATGCAAAGCTGGACAACAGTTTTGAAGTTGTTACAACCATTGTTGAGGTCATTCGCGGCGTGCCAA
ATCTTGACTGGTTTGCTAAACTTCTGAAAAGACTATTGGTAGATCGCGGTAGCGGCACAAGAAAAATGGCAGCCCGATCAACTAAGGATCGATCAGCTCA
AGTTGCAATCGCAGAAGACCGCTCTGAAAAGATTATTGATCGTCTGGTTTGCTGTCTCATGGATTTACAGGAAGGTaaacttcttcatggcgttTCGACG
GACGACGGACACGAGCAGTTTGTGGCATGTATGACAGCTCTGGCCGCTTTTTGTGAAGCAAAGCCCCAGCTTTTGGCTCGCCACCTTGACACTATTCGCG
TGTACTTGAAAGAGGAGGACGTCAAAGTCCAAAATCTATCTGTTTCGATGATTAACAATATCTTGAGCATTAAACGAGTCCCGCAGACTGTTGCTGGGAG
GCTGGAAGACGATTTGAAGTTTCTTGTGCACCGCTCTCCCCCAAGTGTTGTTGGTCCGAGTATCAAGTGTCTGGCAACCCTTTCGAATACTCGGAACACA
CCGCCAGTACTATTGCTTCGGTTGCTGGAACATTTTTTTCTCAGCTTGCGGGGATACAGTCAGAGAGAGTCGCTCGACAAGTTGTCCGAGAAAGATAATT
ATGTCCTTCAGCGTGCACTGTTTGCTGCGGGGAAGATTGTTGGTTCAACGGATATGGACACTTGTCAGCAGCTGACAAATGAAGCGAAGGTGCTAACGAT
CGGAACTGTGACAGAATCGCTTTATGAGTTATACAAGCATTTCATTCGCGTACCAGGCAACGATGCGTGCTCTTCTAAAGCTGTGCAAGGCATGGGTTTT
TTGTTTCCGATTCGACCGCGTTTGTTCCTGCGGGCACAACAAGATGGATTGCTAAGTGTTCTCTTAGCGTCACGGGTTGGCAAGTCGACCTTACAATGTC
TTGTAAGCATGAAGGAACTTCTGTTGTCTGAAGAAAAGCGTATGGAAAACGGTGTGGCGGCACGGACGATGGACCAGTCGAAGAGTAAAGAGCAACAAGT
TCAAggcgaccaagaagctgatgcCTCGTTAATCGGCAACGTTATGCAGGTAGAGCTGGGAAATATATTAGCATTGTCGCTGCATAAAGTGCCGCAAATG
AGGAAGGAGGCCATCACATGCATCAGTGCGCTGCTTACTCAAGGCTTGGTGAACCCGTTGCAATGCATTCCTACCCTGGTAGTACTGGAGACCGATCACG
TTCCTGATGTTCGGGATGCGGCGTTTTCTCAGTTATTGACGCTGTATGAACGATTCCGGACTCAATTCCACACACCATTGATCAAGGGTATCCAGAACTC
GTACTCGTTCCAACTACGTGTATATGGTAATGCCACAGCTCTGGGAgtcgacgagaacgagaaagAGTTTTGTCTCTTTGGACGATTATACACGAGTTGC
CTCAAGCCAGCAAAATCACACGAATCACTGCTTCTCAAGGCATTAGTGAACCAGTTCACCGACCAGGGGAGTGTGCTAAAGCCATTCACCAACGACGAGA
CGTTCACAAACAAGTTGAAGTATCTGTGCTATCTGGCGCAAATCatgtcgacgctgccgtacgacgtggaggacgaacCGCTGTACATTATTTATTTGAT
CAACCGCTACGTTAGCCTACGACTTGGGTACGTTCTTATTGTCACTGTGATAACTCGTATCTCTGTTGACAATCCTCTTTTTGTTCAGCCCTGTTCTGGA
TGATCTCAAGGAAGCTTTTGCAAGCGCGGGCATCGCACCTgagttgctggaggaagaagaatCGGATCTCCAACAAGTAAACATCAACGAGTATCACCCT
TACGGCACACTGGCTGGGTCCAAGTTGGTGGCGCTACAGAAGAATGGGCGACTTGCGTTTTCGATCGCACTGATGCTCCGGCTGAAGTTTGCACTCAAGC
GCAACTACCAGCTGGACAACGAAAAGTGTGCGACGTACAAACCATCCGCCACAGATGTATCGATGGAAGCGCGGGAACGATCTCCGAAGAAACTTTTGCT
CCCTTCCGTCGACGACTTATGCCAACCCGACGATCCAATTGAGCAGAACTGGAATCTGTTTATGGTTGCGTGGCATGCAGCTCGCAAAGACCAGAAACAA
TTGGACACCGATATGGAAAAAGAGCTGAAACCCAAGCCCAAGACTTCACCAaagcgccgtcgtcgttccCGCACTGTGAGGCGAAAGACATCAGAGAATG
ATAGCAATGATGAGGACGAGTACGTGGAAGGTTTCGCTTCACCAAAACAACGTCGTCGTTTCCGCCGCCAATCCGTAACTGTGAGGCAGAAGACATCGGA
GAACAccgacgatgaggacgagtACGTGGAAGGTTTCGCTTGATTGCTTGCTTTCCAGTGCAGCCACAATTTTGGATGACAGTAAGTACATTTGATTTat
tcttcatcttcatcttcgtctgcCGTACTCTTCATCGTGAACCCCTTTCATCAAATGCATCGACCCATCCGCAGTCAATCTCCGCCGCTTCACATCCAGG
GTTCGGAGGAACACGCCTTCAAACTCAGCCAGTTGTGCATTATACAGCGTATCCATTGTCACCACAGggtccaccagctccagtccATCATGAAACAACT
CCAACAATCTCGTAAAACACCAGAACCGTTCCGACTCCTTTGTCAAAACTTCACACACCACTCGAGCCACACCAAGGATGAAGCTCGAATCATCCATTCC
GCACAACAACGGCGCATCACATGCCGCAATTTCTCTCCAGTACGTGCGGTGCAAATGCACCAGTCTCTTTAGATCTTGCAATGAAGAAACACGaaccttc
tcgtccttgtctcctccttcttcatcctcctgctcttcacCCTCCTCTAAAAGCTCCATGAAATCGTAGAACACTCCACCATTAAAACCTTCTTCCGTTC
CCGTCACATCTTTAACTTGGAGGACTTGCGCCGCTCCCACGACATCTTCAAACATTACGCGTCGTTCGTGTAGCGCAAAACGCCAGACCCCTGGATACGG
AGGCAGCACCCcaaccagcaacaaccagATCCTA