Description :
From Genome Similarity Track
Location :
scaffold_898:147- 2562
Transcript NameFunction/comments
Pl_101936hypothetical protein PHYSODRAFT_492560

Sequence
2415 bases(100 bases per row)
TTTTATGGCTTAACATCTTACCTTGTATTGCATAATTAAAAAAAGTCAAACTACCGCGTTCATGAAAAGGTTAACTATAAATACATTCAGTCTTAAATCT
AACCTATTCCTGCTAAGTTCGAATTTGTGCCCTATGGTCAGGGACTCGTGAACTGCTATTCACTTGGAGTTAGTATACTACTAATAGCACGCTTCCTCTA
AGCAAGGTGCCACTGTTCACACCCACGCTATCACCGAAGATTACGAGCACCTCTCATGAGTTTCTAGCAAAGTGGAAGATCAAGCGTTGAGAGTACGGGC
CCGAGCTGCGTGCCCGTTGCAGAGTCTCTGGTGAGGACTACGCCGCTGTGCTCACGCCCATCGCTGAGTGACACAGAGATGCTTGAAATTATGTGATTTA
CGTCTGCATCACGAATTGGTGGATGTGACAGAAGGGATGCTGATCGCGGAGATCGACCACATAGCTGGGAGTGTCAAGAACGACATTCTGCCTGACACCA
AGGCACTGTTCAAGAGCAAGCTTCGTTTAGACATGACTGAAGACGACGTGGACGCCAGAGCGCTGGATTACTTCAACACGTTTGGTCAAGTCAAGCGCGC
TAATGGCCTGACAGAGTGCTTCGAAGGGGAATCAGGAAGGCGTGAAAAGCGCAAGCGGCTGGTAGCTTCGCTACACCCAGCCACGCTGAAGACTGGAGTT
AAACAGTGTGTCCGCTTCACGCACAAGCTAACCGCAACTGACCCACGACTGCTGTTTGAACTCATTGTCGAGAAGGCTACTGAGCATGAGCGCCAGTTCC
AGCACCTCAAGGCTACTAAACACGACAATTCTGAGCGTGACAAAAAGCTGTCTAAGAAGGATTTTTATAAGAACAAGAAGAAGTCGCAACACTCAAGACC
GTCCCAACCGCCGTCTAAATATCTCAAACAGGTTTCAAGGCCGTGGTGTTGTCTAGAAAGCGGCCATCTACCAACCGAAGGTCACCGGGGTTGTGTGCTA
AGTGCAAAGAGATGCACCGGAATCGTGAGTGTATACCGAGGAGGAGAGAGACGAGCTTCACCAGCAGCTATGTGTTCGCGCCAAGACCAAGCGTGCTCGG
CTGAAGCGGCTCGGTGAACTTCTACCTACCTCTGGTCGTGAAGTCACTGTGAATGGTATACTGAAGCTTCCCTAGTGCCCAGACAGTGGTTCCGATTACA
CTGTCATCTGTCGTTCACACTGGGACTTACTCAAGACGAAAGACCCAAGAGTGCGAGCTGAAAAACTCGAGCCACACAAGAGTTCTATCCTACATGACGG
ATGAAAAGATTTTCACTCCTCGCCCCATGCCGCAAGGCAGTAGCAATACGGCTATCTTTTTTCAACAGATCATGGAAAAAGGTTTCGCTAGTCTACTCTC
CGAACGCTTACTCATCTGGATTGATGACCTCCTTCTATATGCCACCGACATTGACACCTACCTCGTTATACTGAGCGAACTATTCTCACTCCTTAACCAA
TTTGGGTTAAAGTTGAGTGTGAAGAAGTAGAGCTTATACCAGACGCAAGTTAAGTAGTGTAGCCGGGTTATCGATGGCAAGGCATTCGCCACGACGACCA
CCGGATTGACTCCCCATGTGCGATGACATATCCTCGTACAGCTGCAGAACTCCAGCAGTTCATATGTGCTATCAACTGGATGCAGGACAGCATCATCGAC
TACGACAGACAAGTTGAACCCCTCCAGCGACGACTCGACATTGATCTTGCTCACACAAAGCACACAAGCGAGCGGCTGCAAGCATTGAGGTTGAGCTCGA
AATCACGAACGACAAACATTTGGTACCATCAAGGAGGCGTTGGCGAACGCAGCCACCCTCGATTTTCCTGACGACAAGGCAACTACATGTCGTTTTACAG
ACGCTTCGGATGCTGGCTACGCTATTGTTGTTACTCAAGTCTTGGACTTCGACCCGTTGAAGCGAGTAACAGAGCAACAGCATCGTTTGACTCACTGCAC
AAGTGAAAGATTCACTAGTAGTCAACGCAACTGGACTGTGATAGAAAAGGAAGCATTTCCTATAGTGGTGGCATGCGATAAACTGGATTATCTGCTATTA
CGACCTCGACCTTTTAGGATGTAGCGCGACCACCGAAACCTAATTCACATTTTCGGACCTCACGAGTTGGTGAAGAAGCACGTCAAGGGCAAGTAGCTTC
GGTGGGCGATGAAACTTATAAACTATAGCTACGTCGTGGAGCATGTGCCTGGACATACCAACGGATGGGCGGATTTGATAGCTCCGTGGGCCGGGAATCA
TACCCCTACTCTGAAACGCTTGAGAACGACTCGAGCTGCACCTACCGTGGGTTAACAGCCTGTTTCTGCTTTACGACCACTAGATGATGACAATTTCGTA
TGAAACAATGCAAGC