Description :
From Genome Similarity Track
Location :
Scaffold_3141:147- 2018
Transcript NameFunction/comments
Phypl_g15643hypothetical protein

Sequence
1871 bases(100 bases per row)
CGTTGTTTTGGCTGCAACGAGTTGGGTCACTTCCGTCGCAACTGCCAGACGAACCCATGGCGTGTGAATCGTGGTAAGACCACtacggcgccgtcgtctc
TCAATGTAATTGAGTCCGATCTGCCGGAAAACGGCGGCTCCCAGTAGGCGTGGGACGCCCTGCTGGGAGGCTTCGCTCCTTTCGGACGCAGATGGCTTTG
CCATCTCCCCGTCCGGAGAAGCAAGTCCCGGAGACGACACTTTTGTGTCTCTCGGTGGCGGCTGGAAGTCTAACCTTGTGGTCGTTACCGCCAGCGTTAA
GAGGTACGAGGAACCTATGACCATCCTGATCGATTCAGGTGCGTCGTACAATTTCGCAACGAAAGCCACTGTGGCTAGGAACAGTATATTGTATGCTAAA
TCTTTAGAATACTCTAAGAGTAATAGCAACGTGTCTGTTCGCCTGGTGACTGGTTCGATAGTATCGACGCGGAAGGTTCTCCTCCCTTTGACGGTCAAGT
TTGACGACTTTAACTCGGTCGAACCGTTTATTGTCctcgacatggacgagcgGTACGACCTGATCCTCGGCATGCCGTGGCTAGCCAAGCATGAGCCGTG
GATCGACTGGCGCAGTCGCACCATAGGTGCTAGTCATCATCCCCTCGCGGATCGAGTTTTGGTGGGTCATGTCCCCTCCTCATCTCGCGACGGGTTTGTG
CGCGAGCACCGTGTGCCACACGGGGAGCGACACTTTGCCGGTACAGCCGAAGGAGTGCGCGTTCCAGAAACTATAGATGGTCGAGCAGTGGCTCCCATGA
CGCAGGGCGCTCGAGCTGAGGTAGctcacgttgaagcagacgcTGACGGGATTCGTCGCGTCACTCAGAGTGGTCGAGCAGAGGCTCCCACAGTCCAAGG
CGTTCGAGTTGAGGCAACtcacgcagaagaagacgctgacggcgcTTGTCGCGTCACCCAGGGTGGTCGAGCAGAAACTCCCACAACGCAAGGTGTTCGA
GCTGGTACAGCTCATacagaaggaggcgctgacAGTGGTCGTCGCACCACCCAAAGAGGTCGAGCAGAGGCTCCCACAGAGCAAGGTACAAGGTCGACGC
GCTTGGGGAAAAGGCAAGATGGCCCATCGGGTTCTACTCCAGCaattgtcgtcgtcgacgcagtTACCGGGAAGCGGTCCACGAGGATGGATCTCACCCC
GATCCCGGCGGTGTCGGAGCtactggagctcgaggagctctccTACGTCGAGTTTCTCGAGTCGCTGAAAGCGGGAGAATTAGAGGACCTCCTCCTTTGT
CGGGAGCAGACCTCCGTGGAGCTGAATAACTTGTCGGTCATGGACCAAGAGGTGTTGGAGGGAGAGAGAGTCTCTCGTCGGCAGCAACGGTATGGCGCGG
CCATCCTGCGGATCCGTACTatccgctgctgcgggagTACGCAGATGTGGTCTCGGAGGACCCACCGTCAGTGTTGCCTCTGGATCGCGGTGTCCGACAC
GAGATCGACCTGGAATCGAGCACCAAGTACTGTACCACAAGCCAATGGCCGCTGCCGAAGGAACAGGTCGATGTGATCGACGCCTTCTTTGCGGCGAAGC
ATGCCGCAGGCATGGTGCGCGAGTCTAAGTCGCCGCATTCAGCCCCGACATTTTGCGTGCGCAAACCCAACGGGAAATGGCGCATGGTACATGCCAACAA
TAAGCTGAATGCAGCCACGATCCCGGCGTCAACGCCAATCTCTCGGAAGGACGTGTTGCAAAACAACATGGCGGGGTGCACGGTCGACAGTGCGCTCGAC
ATCGTCGATGGTTACTATCAACTGTTGATGCGCGAATCGGACATTCCGCTCACAGCGGTGagtgcagcggg