Description :
From Genome Similarity Track
Location :
Scaffold_9:147- 1503
Transcript NameFunction/comments
g5455.t1hypothetical protein

Sequence
1356 bases(100 bases per row)
TCATCACTTGCTTGCATAGTTTGGAAGCGAGCTCTCGCACGTGTACCTTGGTTGAATTCATACAGTAAGGCACCACAGCTCAGTTGTGTCACTGGTAACC
ACTCGGGTTCATCATAGCCTTTCCACTTGATGAGGTACTCTCGGCGCCGCCTGGAAGTACGAGTACGTTTGGACCAACGTAAGTCCAAAATCTTTTCAAC
TTCGTACTCGTCCCTTCCAGCATCCGGTTCCCAACTGTCTTCTGGAAGTAGTGCAGCATCAAAGTCGTCATCTTCATTCACGTTCAACTCCATATTCGGG
CGTTTTGGAAATAGAGCCCGGGGCTTCAAACGACTGATGTGCACCCAAGGGTTGACACGATATCCGGTGTCCTCGATCTTGAGCTTCACCCTGAAGTCAT
CATGCACTTCTTCAATCCGGAAGGGGCCATGCCACATGTGGGCCAACTTTCTGCTCAGTCCAGGTTGGACTTTCGGAATGTACAACCACACCAGGTTACC
CCTTCGAACCCGGACTTTAGTCTGTCGGAAAGTTCTTTCCACTTCTGCGTTTGCGCATCCGAACGGTGACGCTTAGCTTTCTTCTGTAGGTCTTCTGCAC
ATGCTTTCGCATAGCTGTAGTCCCGTTGAAGCTTTCGTCGCCACTCATAAGCGGTTCTCTCCTGAAGGCTTGATGGCTTCGGACCCAACATTGCAGATAA
CGTCCCTTGGGCATCCCATCCGTGAACCAGATAAAATGGCGTGTCCAGGCGAGTTGCGTCGAATGACGTATTCAGAGCGAACATGAGTCTTTCTGAATGA
TCGTCCCAATCACTCTGATCCGCTTCCGAAATGTACGCACGGATGCTCCTGACTACCGTCTGGACGGATCGCTCCTGTTGGCCATTTGCCTGGGGACGAT
ATGCCAGTGTGGCGCGCTGTCGACTTCCTAAAAGTTCTCGAAAGCGGGTGAACACCTCGCTCATAAACCTTGGGTCTTGATCGTGACGTAACATCGAACT
TGCTCCAAACCTTCGGAAGACGCACTCTTCGTAAGCTTCCGCTACGTCCTGAGCTGTCGTCGAACTCATGGGTTTGCACATGACGAATCCGGAAAACGTA
TCTTGGAACAAAAGTAAAAAGGTGTTCCCACGCTCGGACTTCGGCATGTGTGTCACAAAGTCCATCGATACAACTTCGAAAGGTCTTCTGGGTTCGATGT
TTCCAGGCGACGGACCAGCATTCGGAGGCCGTCCCTTACCGCTGGCACAATCAACACATTCCTTCACATAGCGTTCCACGTCCGCATACATACCAGGCCA
ATAGAATTCCGAACGCAATTTTTCGTGCGTCCTGGTGATGCCTTGATGTCCGCCCT