Description :
From Genome Similarity Track
Location :
Scaffold_327:147- 1317
Sequence
1170 bases(100 bases per row)
CAGCGCCGCACGATGTCCCGCTAGCTGATTCTACGGAATGTGTAGCCGTACTGCAGCTTCCCGCAGCAGACGCAGCGCGCCCAGGAATCCGTCGTAGACC
GCTGTGGGCTCAGCAGAAGCGGGTCAATCTTCGCCTCGCATTGCTTGCACGTAGGGCCCACCATTTTGCAAACTGTGAGTAAGTTAGTAAATTTTATTTC
TTTAATCAATTACTTGCGTCCAAACATTAGTCAATAGCAAGGAAAAATAAGGCTGGTATCTATTATTTACAATTATTAAAAAAATGATTTTTAAAATTTT
GGTTTTGCTATACTAATACTTTTATCATATTTTCAAACAAATACATACTTTACAGGCAATAAAAGTGACTAAAAGACTTAATGTACCGTGCGCGCATGCA
TTCGTCGGGTGCAGTGCACGGGAGCAGATAGCGCAATGACCGTGCAGCCGCGCGCCTTCATTGCACGGTGGCAGTGGTGAGTGTCAGGTGAAGTAAAAAA
GATATCAAAAGCGCTGGTCGTGAAGCCTACTTTAATATTAAAAATACTATCGTCTTTACTTCAGAAAGTGTTTGGAAAATAGCATTGCCGAGCGCTTACA
AATGCGGCCTGTGAAGCTTATTTTAATAATACTAATACTATTAATATCTTTACTTTGAAAAGTGTGTGGAAAATAACATCACAGAGCTCTTACAAAATAC
TGGTCTGTGAAGTCTACATTAATAATAATAAATATCTCTTTTTTGAGAAGTGCTGAGCTCTTAGGAAATAAAGTGGTTACTGTGCCCGATTTGCAGTACA
TACGACGTCAATAATCAAGTATCTGCGCAGCTCGCCTAGCTGTTTGCAGCCAATCGATGTGTTTCGTTCTCGGCAGAAATGTTTACATCACGTCCAATCG
CGAGGGCGATAGACGGTTAGAAGCGGAGCGATTCTCCCCTCATTTCAGAACCTGCCGGCTCAAGAAAAGATGGTTGAAATCTCACTGGAGTGTGCAATCG
AAGGCCAGGTAGGCTCGTTCGACGTGACGATCGACGACGGCAAGAAGGTTTCTGTGTTGAAGGATGCGATAAAGGCGAAGGATACAGCGGCGATCACGTG
CGATGCCAAGTACCTGCAGCTCTCTCTGGCGAAGAAGGGCGCAGGATGGCTACCAATTGAGGACCTTCGT