Description :
From Genome Similarity Track
Location :
Scaffold_608:147- 1223
Sequence
1076 bases(100 bases per row)
GTGAGGATTTGACTTGAGTTTTGTATGTGTACCATTTTTGCATTCATAAAAATGTCGGCCACACTGCACGAAGAAATCCATACAAAACATGGGATTTGCA
CGACCTTTTCATGAGAAGTACCGATTATTCGTCAACCAACCGCTGTACCACTTTCTTGGTACTGTCTAGTGGGATTAACGGCTCTCTTatataataataa
taatatGGTAGTTGCAGTGCAAGAAGCCTTgcccagctgcagcgcgacaCGACTGAGATCGTCACAAGTTGTGTTGGTTTTGTTCGCAATTAAAATTGCA
TTTTGTCGGCAAAACTAAATTTAAATCGATTTAAATCCCCGCTGGACCCTCCCTCGGGCCGAACGATGGCCATGCGTACACTTGACTAGCAAGGCGCATA
TAGCTTGCATGCATCCAGAATGAATCATGGGGCGCTCACGCACGATGTATGATGCAGAGTTCATTTAGTTAAACCAAAATGCTTCAAAGCTGCGGCCAAG
TAGTCAAGGCTGTAATCGAGAAGGTAGTCAATGCCGTGGCCCAAGCGCTCTTCGACTACAACAACATgtccttcttcctcgtctttACCTTGTTCATCAT
CGCTGTcctcatcgctgtcgtcttcaCTCGATCCCAAGGCtagctcgcgctcctcctcgcgaGGTGGCACTTTCAGACCAGAATGGCAAGCACTCCTTAG
GCGATGGAAGCTCGGTAGGTCAACGATGCGAAACGCCGACCCTGACTCATAAACGAAGTCTGCCGCAAGCGTGTTTCGTTGGTCCTGCGACAGGGCTGTA
TACTGCATACGCTGTCCTTCTGAGCTTCCCAAAACAACTAGACGCCATTCGCTCGGCTCTTCTTGcgggcttcctcttcttcacgctctTGATTCGCATG
ATTCCTTTTCTTATTCTCCACTGTAGTGTGTATCCGTCGCAACGCGTCAAGtggttctcgagcttgttcACTTTCGGGTTGCAGATCTCACTTGAACAGC
GTAAAACTTGACGCGCCCATTTTCACTAGCCTCACTGAAGAGCTTCCGGGGACTGAATTTAGGTTGACCTACAGGC