Description :
From Genome Similarity Track
Location :
Scaffold_47:146990- 148587
Transcript NameFunction/comments
Physo_136640NADP-dependent malate dehydrogenase (oxaloacetate-decarboxylating)

Sequence
1597 bases(100 bases per row)
GCGTCTTGCCAACACCGCGCACGCAGCCTGCTAACGAGTCGCATCTGATCATACATGTACATGTTCCGAGGTGGTCCATCGCTGGTCATAATTTATGTCC
GATGCACCCTAGCGAGCTGGTCCATCGCTGGTCGTAAGCAAAGTTCGATGCATCCTAGCGTTGTTGCTCCGTCGTCCGCGCACCACGCGCTTTCACTACA
GCAGAGAGCCACGCCGCCCCCCGTTGCACCAGCATATCGTTGCAGCAGGCAGTATCAAGTTAGGTCGAGCACACCCGGCGACTCAGCGGCACTAACAAGT
CTTCGACCGTCGAGGCCACGCACCAGCAGCCTCGGCAATGAGCTCGTTGTCGGAGTTCCCGTTTCAGCACCAACAACACATTCACGATCGATGAGCCCCT
CAGCAAAGATAACACTCCCCGCACCATCGCCGCTGCCTTGAGCTGTCAACAAACATCGCGCGCATTCACCCCGCGAGCTCAATGGCGGCCAATCCAGCAA
TGAAGGCCCCGCAGCACGTGACCTTAGGGCTTGCTGCCGTTTAGTGCCCGCAGTACTGTCGTATGTTCGTGCTGCTCGAGGTGCAATCCGTTGCAAAAAC
AGCTCGGGCCTGCAACCCGTCCACCAGCTCGACGGTGCCCATCCTGCGAGACCGCGTTCTTCCTCGCGCCGACCACCCATCCGGTGGCCCATTCTTCCCA
GCCTGAATCAGCGCATACACCCGCGGTCGGTGGCTTGCTGCGAGGAGCTAGCGCTCAAGAAATCCCCCGGCGACTCCAGCGTTGGCGCTGCAGTGCGAAG
TCCTTGCACTGACTGCTGCCCATCCTAGCAATTGTATCTGCCCGACGCCACGGCATTGGCTAAAAGGCGCGTATCCGTCCCGCGTTTCAGCCAATGCAGT
TTTTTGGCGCATTTTCCGCCATTCGCGTCGCGCGGCGCCGGCTGGCTTTCGGCCAATGAGACAGAACTTCAACCGGATACTTTTGTGTGCCGAACATAAA
AGACGCCGGTGTGTCAAGGCGTTCGTGTTCATTCGGCGATTCGCTCCCAAGCAGCCAAGCCCAAGCACCACTCGATCACCATGCTGGCGCGCCAGGTCCG
TGCCCAGAAGCGCTCCCTGCAGGTCGCCGCGGCCGCCGTGCCGCGCACGTCCTCGGCGGTGCACGCGCGCTTCCTGTCGGCGCCCGTGTCCACCGAGGAC
CACGAGGAGGACGAGGACGCCATGGACGGCGGCGAGCCCACGGGCTCCGAGCACGACATGCTGGACACGTACCTCACGACGCTCAAGAAGTACAACCCGC
CCATCAAGACGGGCCTCAAGGGCCTCAACATCGTGCACGACCCGCTCTACAACAAGGGCACGGGCTTCCCGCACGTCGAGCGCGACCGCCTCGGTACGCA
ATCCACGGTGTCTGCAGCCGTGTGCAGTCTATTGACTCTGGTTCTCTGTTGATGATGATGTTGTAATGCTCAGGCCTGCGTGGTCTTGTGCCGCCGCGCC
GTCTGATGGTGGAGGCACAGCTCGCCAAGCTGTACGACACCTTTTCCGAGGAGAAGGACCCGCTCAGCAAGAGCCGATTCCTGACGGACCTGCACGA