Description :
From Genome Similarity Track
Location :
Scaffold_148:146959- 147972
Sequence
1013 bases(100 bases per row)
TTTGTAACAGAGCACTGCTTATGGCAAGGTCAGATGCGTCACAGACGACACTGAAAGGCCGATCAGGATCGGGCAAAGCCAATATTGGCGCATGAAGGAA
ACTTTTTTTAACTGCTTGAAAAGCATCCTGTTCGGTGTTACCCCAACACCAATTCACATCCTTCTTAATGAGATTGGATAATGGCCGAGCCATATCTGCG
TAATTCGCGCTATACTTATGCAAGTAATTGGCAAGGCCAAGCCACTTACGTAGATCTTTCTGGTTCTTTGGAACCGGCCAATCGACTATGGCTCTTACCT
TAGCGGGATCCGCTCGAAGGCCTCGCTTCCCAATGAAGCACCCCAGAAAGGGAATCTCCTGCACCAAAGATGCACTTAGATGCATTTGCATACAATTTAT
TCGTGCGCATGCACTCGATCACCGCTCGTAAATGATCAATGTGATTATCCACATCAGATCGACCGTTCGTTGCACGACTATGAACAAAGATGTCATCAAA
GTACGTTTGTGCATAGCCTCGATGAGGTCTGAATAGTTGCGTCACCAGACGATTAATAGTAGCCGGTGCATTTGACAGCCCTTGTGACATAACGAGCCAC
TCCCAGAGCATACCAATCGAGGTACTAACCGCTTTTACCGGAATATCGCTTGCTCGCATGAGCAGCTGGTAATAACCATCAACTACGTCGAGCGCACTGT
ACAATGTACATCCCACCATATTGTTCTGAAGAGCACCCTTTCAGGGGATTGGTGTCTGAGCCGGGATAGTGGCAGCATTGAGCTTATTATAAGCGTGCAC
AATACGCCACTTACCATTAGACTTTTTTACAGAAAATGTAGATGTGGGATGGGGAGACTTACTCTCCCGCACCATTTCCGCCGCGTGCTTAGCACGAAAG
AAATCGTCAATGACGTCACACTGTTCCTTAGGTAAAGGCTACTGCCGTGTTACGCACTATTTAGTTCCTGGAACTAAGTCAATTTCATTACGTACACCTC
TATCGGGAGGTAA