Description :
From Genome Similarity Track
Location :
Scaffold_86:146933- 152334
Transcript NameFunction/comments
Hyaar_Emoy2808718AlNc14C624G12274

Sequence
5401 bases(100 bases per row)
CCAAGCGACGCTGGTTGCGCGTGAATCCGGCTCGAGTCATTTAGCGACGTCGACTATGCCGCGGACAAAAGTGACCGAAAGCATTTGACCGACAGCATTA
TCCTCCTAAACGGCATGGCGGTCGGTTGGAGCACTAAGAAACAAGACGGCATGTCCCTTGCCTCAATGGAAGCGGAGTTCGTGGCGGCGTCAGAGATTGC
TCGCGAGCTGCTGGGCGTGCGCGAGATGCTTAGCGAGATCGTAATGTCGCCAGAGTTGCCGATACTGATGCACGTCGACAACCAGGAGGCAATTAGACAG
ATCGAGGGTGAGGTGTCGTCACTCAAGGCAAAGGACATTGACGTTCGAGTCAAATTTGTTTGCGACTTTGCTCGGCGCGGGAACATGCGCGCAGTATATG
AGATCGAAGCTAATTCTCGATGATCTACTCACCAAAGCACTTTACCCGCCTAAGCTAGCGACATTGCGCACTTTGGTGCAACTCGGTTAGGACGATAAGT
CGTAACCGAGGAGAAGTGTTAGAAAAAGGCGTTGCTGCCCGAAATGGTTGAAGTTACGGTTGGAGTAACGGCTGACGACTTAGAGAGGCGCTTAAGGATT
AGTTGGGTGATTGATTGGACAGGTGTGTGTATGGCTACTTAGGTGGATAGGAGTGATGGAGAACAAGAACAGCTTGTCCATCATGCTATCAAGAAAAGAC
AACACTACAAACAATGACAGAATCCTTTTATCACAGCGCCACCGACTTCCTCTCTTCAGCTAGCACCATGGCAAGCGAACAGGTTATGAGCCCAAAGACA
GAGGCAACCGACAAATTCAGGACCACGAATCCCCTAGGCAACCACCTTTGAAATGTCCGAAAGGGCAGGTCTGCGTCCACGATTTATCCGACCCATGGCT
TCAGGTAACAAAAAAATACGCAGAAAATCACAATATTTTAAGGGATTTTAAAGATACACACCCACCTTTCGATACGTACACACCCAGTCAAACTGTAAGA
TAGGGGAATAAGCTCTGGAGCTCGCCCTTTGATATAAGTAATTCAGTTCGGAGAGCTGAAACAAGTTGCAAACCATTATACAACAGCAGTCACTGAAGAA
TGAGTATGATGCTCTTGATGTCTGTAGTAATTTAGTACAGTATGCTAGGGCAACGCGGTCAGGCTTTGCTTATGAGGGTCTATCATTTTTTTATGTGATC
ATATTCACCTTCAATAGATTTTAGGCAATTAACTAGCGTGCGTCACAATAGTGTACTATTTGTATGAATTGAAATATCAATTGGTGGTATATTTTTAAAT
TTAAAAAACTCAGTTTTTAATTCAAAAAAATCTAAAATTTGAAAATTTAATATATTTTTATTTTTGAAATTTACTTTAAATTTATAAAAATTTGGTAACA
TAAAAATTATTAATTTTTCTAAAAAATAAACATACTTTTTTTTCGTAAAGTTACTTTACAATCTATAATTGAATTTTTTTGATTTTTTAAAAAATAATAT
TTTTTTTGATTTCGTTAGTAGAGGTTTTTGATGTGACCTAGCCAACGAGTGACTTCGGATATACCTATACCTATGAGGGGGATAGGCTAGATCGTATTCA
TTACGAGTAAGGTACACCTAACTTCGTTATTTACAGACAGACACACACATAAATAAGTACGATTTAAACAGTTCGGCATTCAGCTTGCTCACAGTCACTA
ATAGCTTCACCCTTCGGGCTCGCAACTAAACAGCACTGCGATCATACTTCGCTCGATTATTGTTTCGAGGTATTGTTGAAGCATCCATTCTATGGAGTTC
AAGCGTGCAACAGATTACGTTAGTCATCCATCTTTACTATACTGTCTATATATAGAAACGTAACGCTGATGATTCATGCACCTTGATAGAAATGACAAGA
GCAGCATAAGGACCCATCGACTTGAGTTCTGGCATGGCACTGCCGCCGTCCACCGTACCCGAGTACGAATGGCTCAACCTTTCTTCTCCTGCCGCCAGTG
CATACCCGTTCGATGCTTCCGTGGCGTCCGGATAGTTCTCGAACGAATGAACCACCTCGCCGTGGAATTTATACGTGGCCTTCATTCCACTCATCTATGC
TGTTTGTTTCTTGCCGAGTCGAATCAGAACAGGTCGATAGAATTTTTTTACAAAAAAATACGTTGCGTTCGTGCGACATCTTTGCACAAAATGACAATGA
GAACAAATGCGCTGCTGGAGGAACTACACATGGCCAAGGTGCTGTATCACCAGTCGGGCGTGTGTTTGTTCACACACCAGTGAAAGTGGAAACCACAAGC
ACATGCCGGAGGTTTCGACGCGCTTGTCATGTCATTTACGCAGTTTGCGCACGAGATTGCCGGTGGAGGTGCGGGCCGTGATCGGTGTATACGCCGTGCA
TGTATACGCTCTCTAACTGCATGCTGTATGTTAACATTCTAGAGGTCATCCATGTACAATTTGACCCGAGTCAAACCTACAAGAAGGACACACAGAGCAG
AAGAAGCTTTATGCCAGTAAATTCGGGTAACAGTTTCTATAATCCAGAAGTCAAACTGACCTGCTAATCTGGTCATATGTAGAACTCGTCTGGCGGTCTC
GTCATGATTTTGCTCCAGAACGATACCATTCAGGCTGAACTGTCCCACGAACGAACTGGTGAGGCTGCAAGTGAAGCGCTTAAAGCGTTCCTACTGTGGA
TTCTGCAACGGTTTAAAGAAGTGTTTATATAAAGAGCTGGCGCGATTGCAGCCGCAGTTACACGCGAGTGCGACTCCCACATCAGAAGAGGTTGATGTAG
ATACTGGAACAACAACATACACACGAAACTGGGTCCCTACCTTTTCGCAACATTTTTGTGGCTTTGTTGTATGTTCCTTATAGCGTGAAGCCGTTGCAAC
TGTTTCGGAGATATGAAGCTGAGCTGGATTGTCAATTGCTACTGCAGTTCAGTGGTGAACTCGGTATACAATTAGCTGCTGGCGCGATGAACCGGGGTCT
TGTACGGGTCTGTTTTACAGTATGGATGTATGTATCGAGGCTATTCGAAACCGAGCTGCAGGCTTTCACTGCAGTCAACTTGAAAGATATACCACTGCTG
TGAGTAATTTAGAAGTATCTCCATTATCACTATAAATACTGCGGACTAGGAATCTGCCTGTTTCGTGAGTAAATATGATTTACCGTTGTCATGCTTTGGC
CCGCTCAGCTTAAAAAATAGTCCCTGATGTTGGTGCTGCTAGTTCAACACTCGTTCATCGTCGGTCACTGAGGCGAACAGGCTTGTCTCAAGATGCGAAA
CCCCATAGATCCAATTGGACACAACAAACTTCTGCGAAGTAGCCTACGGAGGTGATTCGAACGTTTTGCACGTTTGATTAAGAATAATATAACTTATTTT
TTGCATTTACGTTACAATTTGTGGCAAACGTTTTATTTATACAGTTTGACTGGGTGTGTACGTATCAAAGGTTGAATATTTACCTATAAATTTACTATTT
TAATTGCGTTGAAAGTCACAGATAATGGAGCCCTAACACTTACGTTATCTGTTAACTCCTTCTGGGGGCGATGTACGAGGCCGGTTTTGTCCAAAGAACA
CCGCTTAGTAGCCATTTGAACTGCAGTAGGTGTTAGGATCATCAATACATTTGCTAAAATTATAGCATCGCGTGGATTCGTCGAGTTTTCCACTTGTGTC
GTCCGTAGGGCAAATTTCCATACTCGCCGCATGACGGCAGATGGTGTTGGCGATCACGTTTGCTAGTAGGCCCTTGGCGTTCATTATAGTCTCAGATTGC
GGCTTGCACGGCTTGGCGGCTTGACGAGTGTGTCCTGTTTGGCAAAAGGCAGAATGACAGCTCGATAATAACTCCCTGGAGTCGAGATAGCCAGAGACAC
AGGCGAGGTCTAGCGTCCTCGTGACACATGGACGTTCACCATAAAAGTCCAATAGTTATATAGCGAAGATATTCTTACTCCTTTGTCAGAGGAAGACTTC
CAGACTCGTAGAGTCTCTTAGTATATCAAACTAAGCGTGTGTTAACTTAAAGGGTCTCAAGTCTTACATACATAGCGAGACTTAAGTCTAAGTGTATGTA
CAAGCTCTTAAGCTTCTAGTCCTGGTTCAGGGGACCACGACTCCAAGGAATCACGTGGTACTAATCCCCAAGAGTACTTAGCCTTAGCTCAGGCACTTAC
ATATTACGACCAGAGACGTCTTTGAAAGACACGTGTCTGAAACTGATCAAAAGGGGAACTGAATATATTTACTGATGTATAGTGATAATAAACCTTACTT
ACGTCTTTAACCTTAAAACTATGCAACCTAATCGAATAGTCCTCATCGTAGTTCTTGTTGTGTACCACATCAGAACTACGTCGCCTCTATGAAGACCCTA
TTACCATAGGTATCCTCTAACCGTAACCTATAGGGTATGGTATTATCGTTTAGCGTATGTGATACAAAAGTACGCCTTATGAGTGATACTGATCTCTTTC
TGTGTGTATCACATCAATGTACCTGGTTATCACAATCATTTGTGTAACCCCGTTACACGTTACACCAACATATGAACATCAGATGGTGCCCTAGATACAC
AAATCAGGGTTAAGTGGGATTTGACCAGTTGACTTTGCGAGTGTAGATCCCTGTCTGCTCTGGTTTTGGCTGTGCGTAAACTTTCAAGAGGATCAGTTGC
GCAGCTGAGATTAAGCAACAGGGTGAGGATAGCAGAATACAAACAAATCAGGAATTAGTGGGATCTGAACAGTTGGCTCTGCGAGTGTCAAAACCTTTCT
GCTCTTGTTTATGGCTGTGCGTAAACTTTTGGGAGGACAAGACGAGCAATTGAGTCAAGCGACAGGATTTGGATGGCACTAGAAAAAGATGATTAAAAAT
AATACAAGGAGTTGGGGAATTCTAAAAATACCCAGCGCAGTGGAGAAACTCTAAATACACCCAGGCGCAGTGTTCAAAACACCGAGGTTCTATTCAGGCT
ATCCATTTGTCATATATATTATATGCAAACAAATATTACATAGACAATACGTGACCTTGCCCTTTTCTTATTTTAGGGCTGCATCCTCATCATTGTGATG
TGCCTTCCAGCCTTCCCCTCTGGTGTTGCAGCTCACGATGATGAGCCATTCGTTGATTCAGCGTCGATCATAGATACTCATGAATCTAAAGCCGGATGCT
ATGTCGTTTTATGACGTGGTGGGCAATCCTGACGCTCTTGTACCCTCCGCTAAATCACTTGCTTCACCAGCAGGGTTCTGTACTTCTTTTTGGCGTTTAC
TGTATGCTCAATTCAAGCTTTCGTGTTCCTATTCAGTTTGATTTTGGCGCCTGAAAGCAGTGTCTCTACTAGAAGCTACAGAAAGTCACGCAAGTGTAGT
T