Description :
From Genome Similarity Track
Location :
scaffold_38:146920- 158854
Transcript NameFunction/comments
g12685.t1hypothetical protein
g12686.t1hypothetical protein

Sequence
11934 bases(100 bases per row)
TTTAACCTGTCCAAAAGGGACGGAAACAGCGTTGGGAATCCGTAGTGGATTGTCGATGCTGTTTCTTGCTTCACCGCATGGTAAAACCACAGTACTTCTC
CTGACATCGATACTTTTGGTACGTGATCTGCAATCGAAAAAAGTAACTCACGAATTGAGTAAAGAATCCCTCCAGGTTGAGATGCTGCAGCTGGCAATCC
AACCTCTGACCCGTCCAAGCAGCTTCGCGAAAACTACCAATTAGAAGGGTTTTGACAAGGTGAGTAAACAAGACGGCAACCAATAATAAACAAAGGCGAA
GCAGGAGACCACGTACCTCAAAGAAATTCAGCTTGAGAAGCCTTATTGTTACAAGTAGCGGGTACAGAACATGGATAACCTGCGAAGTGGGGTTTGGCGT
CTCATCAAGGATATCCATTTCAAAGTATTGCGACGTGGTGCGTTTCAGCACTGCGTATAAGGCGGACAAGGTCGACTCTTTTGGATCAATGCATAGTGAT
CGATACAAACATCGTGAGAGCTGGATAGAGTCCGTGTCATCTCCTGGAATGTCATTCCCAGCTAAACGATCCAAATGGGATAGCAAGCAAACGCCAGAGT
CTAAGGCCTCCAGCGCACAATGCTGGTTCAACCTGTTCGTAGAGTCACATCTAGCCCGAAGGACACCAAGTACGTGGCCAGCTTTTCCTGTCGTCGAGAT
GTTTTGTGTCATATCAAGACTGTACGATCCTGACGCGTTCACTGAGCAAATCTTTCTAATGCAGCTGGTACTCGTAGCCTTCCCTTGTCTTCTAATGCGA
CCCCCAACTAGAAATAAGTCACCATCTGGAGAGGAAGAGGAGTCGACATCAGAGGCGATAGGCAGTGCTGTTACTGTTCCGGTTTGGGCATATAATCCTG
CCGAGCTGCATCCATCAAATGACCCTTGAGTGTTAACTTCGGTGCGGTTCCACTTTTGTGATGTAACGGAGAAGCACCACATATCACACAAATAGGTTCC
TGTCCGATTAACACCTCCAAAAATCCAAAGGTTGCCAAGATCGGAGCACATGCTATAGCTCACTCTTCCCTCTGGCAGCATCACTTGAAGATCGGGCCTT
ATATTCCCACTCGACAAACTACCTGATACATCTCTCGAAGCGCCAATATTATCGTCGTGACACAAATGCCAAAGCCGGTCAAATGTATTGTACCGCCAGA
GATCCGACCGAAATTTCTCTTCGCGATCTTGCCCGCCGAAAACGTACACACATTCTCCAATAACAGCGGACGAACATCCGATTCGTGGGCCAGGATCCAG
AGAAACCGAGCTAGGCAGTCGCGACCATGCATAATCATCGAGGGATAAGTACCAGGCGTCTCCAAGGACCTCGTTGTCTACTGATTTACCACCATACATG
AAAACGATCGCGTCGAGACGAACGCGAATTGTCGAAGCCGTATGGAACGCACGAGATTGGGGCATTGAAGTTGCCGCCCCAAGAGCAGCTTGAATTAAAG
TCCATGTCGGGAGAGAGCCATCAGCGTTCTTCGTTGTAGGGCATTTGTACAGATCCATATGCCGTGATGTTGCACAATTATTCTCGCCCCCAAGCACAAG
GATCTGATTGTCATCAATTGCAACAACCTGGTGATTGCGAATTCCAATGGGTAAGTCTGTCCACCTCTCCCAGGTGCTAGTTTCCGTATCGTACGCCCAG
ACGTGGTTACTTGGTTCAGTAGGCTGGGGCATTGGGGCATCCGCAATAACCATTCCGCCGACGACAAACAACGTGCTATCCGCTAAAACTGATGCAGATC
CTTCAAGTGCCGGTGGATGTATTGCTGTACCTCTTGCTGGCTCATCTGGAGGTGGCTGAATTGTTGCGGTGGAAGAGGGCGTAGTTACCGCGCGTGAAAT
ACTGTCAAATTCATGACCAATCGACGGGGGGTATGCGAACGGTTGGTGTCCTAAATTGATGCGGATGATTTCACCCCGTTCAAGACTGATGCCAGGCATC
ATACCCGATCGCTTGTCGTCTACAGAGCACTTGAATTCAGAGTATGCGACACCCAGGTTGACTCCATTTCGATAAAATGTCATCTCCTGCGTGTTTAAGT
CCAGCAGGCAACCGATGATATCACCAGCTCTCCATTTCTCTCCGTATGAAGATGATCCACTATTCCAGCGTCGCTGGCGGTTACCGTCGTACGACCATGA
GTGAGCGTGATCTCCGACCCCTTCACCTTGGTCTGAGCTTCCCTGAAAGTACCCATCGATCCACCCAACTTGAATCAAGCCACTTGTGACCACCTCTACC
TCATAAAACCACTTCCCTCGAAATAACGACACACCGATTGTTGATATTGAACCGAAGTTACTCAAGCCTTCGATCTCGCCAGAACGATCAATATCAACAC
GACCGCAGACTGACGTCACACAGCTTTGATCCAGCATAACGGTATCACCTTCATCATTATCGCGTTTTCGCTCCACAATCAAGGACGTGGTATAAAAACC
AGCTGCAACATCCAAGCACCGACGGGAATTTTTCTCTGGTCGAACTTTCAGAGGAACAGGCAATAATGCGTCTGCGCTGCCTCGATTTCCAAGTTGTCCC
TTGTTATTCCGTCCGAACACGTAGACTTGGCCGTGTTCTGAAAGTAGCACTGTGTGATAGCACCCACAAGTCGCCCGCATCATTCGCGTATTGGCGGATA
AAGCTACAACATTTGGAAGATTCTGGTGAATCTTGTTTCCGATACCTAGTTGCCCGTAATCGTTCCGACCAAATGAATAGGTTCGTCCACCCGTGGTGAC
AACAACCGAATGGTAGTAGCCGCATGCAACAAAGCATACCATTTCGTTCGGAAGTGTGACGATAGTGGGTATCTTAACTTGACGATTGTGAGCTAGGCCC
AACTGCCCATAGTCATTCTTTCCGCAGGAAAAAAGTTCTCCGGTGGCTGTGCAAATGACGGTATGGTACAGACCGCACCCTACCATTGACACTTCAGTAC
CTTCGAAACTCTTCACAAGCTGCGGTGTGGATTGGTGCTGTGTGTGATCGAGACCAAGTTGGCCACAATCATTCATGCCAAAAGTGTAGAGTTCCCCGGA
ATCCGTGATCACGGCGCTGTGGTGGTAACTCACAGAGGCAAACCCAAGCTTCTTTGTCTTCAATGATTCAATAAGTTTTGGTACGTGAATCTTGGTGGCC
AAGTTTTCATGCCCCAACTGTCCCCGGTCATTGTAGCCCCAGGAGTACGCTAGCCCAGTGTCCGTTAGCGCGATCATATGCTCGCAACCGTTACTCGCTG
CAATAGATTTTATTCGCTGTGAGCGCAGAGCTTGCACGGGGCGAAGCATCATTACCCTCTCGTCGAAGTGACCCTGACCACACTGACCGCTTTTGTTCAA
TCCGCAGGTTAGTACGACTCCATCATTTGTGAGAATCGCCAATGTTTCGTTGCCACTGACCACCTGACGAATATCGTCCCACCCACAAAGAGCTACACTA
GTGAGTTGATGCCGCTCAATATCATCTCCTGTGCCTAGTTCTCCGTACGAGTTCTGACCACAGCTGTACAGCTCACCTGAGGCCTCACACTTTCCATACA
TAGGCTGTTCTTTGAGCGCGGCAAGTTTGGCAATTGATGTCTCCAAATTCACTGCTCTCGTTGGTGGCTGCTTCATTAGCCAAAGTATCACAAATAACAT
TGTCGCAAGCGATCCGCGGGCAAGGCCCACCTCTGCTAGCGTTTCGATCGTGCAAGCTCCGATATGAACTTCACTTTCAGATGCTCCATCATCCACCGGG
TATGCCAGATCACCTAAGCAGTCACTTAGCAAATTGAATGCTGACGATGCGGACGGTGCGAGGTACATACTGTCCGAGTAGGCAGTAGGCTTCAAAGGTT
TCAGGGTGGCCTTCACCATTTGCAGTGCGTGTTCGTACTGTTCTGGGTTGTTTTTGCGTGTTGCCTTCAGTAGCATGACCACCAGGTCCCAGCCCATTGT
CATGCAGTTTTGGGTCGGTAGTGGCAGCGGGGGGGGCGACACTTTACGCAGTGACATGGCGTGAGCTCTTGCAGCCAGGAGTCGTTGTTCGTACCGGTAT
TTTTCCTTCTTCGTCATCTGGTACAATGCCTGCAAGTTTCTCACGTAACTCGCCACCCGGGCGTCGAAAACGCCAGGCATCGCCTCACCCGCATCTCGCT
TACTGTCTTGTCGTGCAGACTCTAGTCCGTCCTGGGACGGCAGCCCTGCCAGCTGTGAAATGTGCTGGAACAACTCGTCCACCGAGTCCACGGAGCTCAT
GAGCTCCTTCATCTGCTGCTCGGGACTGCGTGTCTGCAGTCGCCCGGACACTTCACTCTCTGTAGGGGCACAGAGGTAACATACACGAGGTCATTCCCTC
GTTGAAGATTGAAATACTACCTACTAGAATTGCGTGTTACCTTTCGGTAGGTGCCGCAGTGCGGCGCCAAACTCGAGGATCTTGTCCATTACATCTTTTG
AGTCTTCGGTAGCGGACGGGACAGACACGTCGCCGGCTTTGAGCACGTCGCAGAGCGGGACGTATGGCGCCTGGAGCGGCCGGAGCAGAGTGCGCTCGCC
CGGCGGCTGCGTCACCGCGGCCGGAAGCGAGACCTGCTGCCCCATGACCCGTCGCCAACTCGCAGCTTGCTGTTGGTTGTCTGCTGTGTCTCTTGTGCCT
CTGCGCGCCAGCTCAACTCGATCAGTGGCGAAGATCATCGGCCCGGCAGCCGCGACTCTTCCGGCAAAATGTATCTTGTGTTCGATACATAAAAAACATG
TTGATTGGTTGAAAATAATAGTGCTGTTATGGGCGATAAGTGTTTTGTTTCCTTAAAAAACAAAACACTCGTTATATAGCCCGATTGGGTAACACGAGAC
TGTCCATTCATGCCCAACGAGGTCCGATCCTGGTGCCCGAATGTGCCCGACTAGGAAAGAGTCGGAGAAGCATCGCGCGAGGAGTCCTTCACTGTATACG
TATAGCCGGACATTGGCTTGGAGCGTCGACTTGCATTTTTCAGCCAAGAATCGCCACTCCGATATAATATCAGCAAGTTGAAGGCATCGTGCAGCATGTC
AACCTGGTCCCATGGGGAAGAGATTAGCATAGATAGAAACAGGTTCTCTTGAAAACGAGGAGCGGTACCTTTCCCACGAGTTCTTGTACTGTTTCATCGC
GTTGCGTCACTTCTCGGGCTTGAATCTACATCCAGACGCCACCGCTTAGCTGCTTGAATACCATTTCACGGAGAATTGACTCCTCACCTCAAGGTTGTTC
TTGAGCTCTTCAACATCTGAAACAAGAGAATTCTGCAAGAAACACAGCAACAGGAACTCAATCAGTTCAAAACAACAAACAGCAGTATGTAAGCCGTCGT
ACGGTCTTTTTTGTCAATGACACTGCTGATAAGGACTTGGCGGTAGTCGCCACCCCCGCCTTGGAGCTTTCTGTAGGCCGGCGCAGCGCCACCATCGATG
GATCAGGTCCCTCGCCTGAGCTTCACACTCAGTCGGCGCACGCTATCCGTTATGTCCGTTTCCGGGCCATGCTGTCGAGTGCAGCCTGCGACGTGGCTAT
TGGTGGGCAGACGACTCGCTTTGCCGGTCTTCTCCGCCGCTTGCTGAATCGCTGCTGGAATGAGTGCAAATGCGCCGCGGTCGTGCTTTGAACCATGGAA
AGCACGTGACTAGCGATGCATTCGAGCGGATCCGCACGGCAGAGTTTGTGGCTTGTGTAGCTTCCTATCCGCATCAAAGTGGAGTCCACGATGGACCGCG
TCGAAGTGCAAGACATGGGCTCGGAGACGCAGCAGTGCCGCACCCAGCTTCTTCTCCACTAGCTGCGCGGTTTCACCAACGGGACAGCTGCTGCAGCCTG
CCGTTGGGCCGTCGTGTTAGCTATCAAGAGAACTGATGCCAGAAAGAGACTCTGTCAGCGGGCGCACTTACGATCAGAAGAACCCAAATCCGTCCTTCAT
CCCAGAGCAGCTCGAACTCACGTTTGATCGAATCAAGGTGCGCCTGAGCCGTGCGCCTCTCAAAGATCTCTCCGTGGCGGGCTCCATCGAACGCGACCGC
GCTGTAGTTGCCCGTGCCTTGTTTAATAAACTGCCGGTCCGGAAAACACGCTGCTTCGCTTGACGCTACAGATGAAAATTACCGCGGCTATCTATCTCAA
CTTTCCAGTTGTTTTGCACGGCAAGAGACCACATGTGTTCGTCAAACTCAACGGCGTGTGCTCCAACAATAGGACCACGCAATACAACAGTATGTTCCCA
ATTCAACGTCATTCCCCCCACACTCCAATTGCAGCTTCCCATCGTCAACACGGTTCCATCGATAATCGCTACCTTCCAGTGCATGAGTCTGGGGCCTGCG
TGATATACGTTGACCCCGTTTTCAACCAGTTTTTTTATCATCGCTGAGCTTTTCTCGGTGACTTGTGCCCGATCAACGAGAACACGAACCGTGACACGCT
GGGAGGCACGGATGATAGCGTCGGTCAGTTCCGGATGCGACAAGATGAACATAGCGATATCTACTGAGGTCTCTGCGCCGTCGAGCAAATCAATGAGCTT
CTGAGGTGCAGCTTGGTCGCGAGAAAACCAGTAGTCTACAACTGCAGTTTGTAGTCTACCCAATATGTCCTGCTCCATGCGGCCAAATACTCGACGGTCG
ACCCCCATTATCCTTGCGATGTCCTTGAGCGATAGGGTTTCCGTGACGCTAAGACCTCGTTTCAGCATTTCCACCACGAAACGCATGGGGGTCCACCGAG
GGGGTTTACCTGACTTGGACTCGTCTTGGCTGGGCTGGGCGTGGACGATGGAGTTGATCGTGCTGCAGGCGTGTCCTGTGCTTTGATGCAGCTGGGTAAT
TCTCTCCCCTTTCTGGTATCGCTTGCGAATCTGGGACTTCTCTGCTGGAGTTAGTCGCGGACGGCGTTTCTTGGGCAGCGGACTTTGCGTTCTGTAGGCA
TTCGGCACGACGCGTCGCGAAGCAGTGTACATTTGACGTGCTAGGAAAAACGGAAGTGGCCCGACCTCCGATCCTCCACGTTGACTGAAATAATAATGGC
TCGGAAAGTCCGATCCTCGACGCTGCTGTTTAACTGGCTCGGAACGTCGCAAAGTGGGCAACTTATCCTCGAGTCGAGGATAAGTTGCCCACTTTGAAAT
TTCCGAGCCAATTAATACAGCAAAAAAAAATGTTGGGCAGTGGGCAACTTATCCTCCACTGGAGTGTGAATTGCCCACTTTCCGACTTTCCGAGCCATTT
AACCCTTTCGCGACGCCCTTGGATAAAGTATACTATACAAGGTCAAGATACTCCGATCTAAAAGGGCACAAAATTCGCCCTTTAAGGTTTTCACGGTACT
CGCGTGAGGCTTGAGTGCTGTTCACTATCCTCCCGGATGCGGGATAGAGAAAGCCGGACGGTCTAAAAGGGTACAAAATTCGCCCTTTAAGGTTTTCACG
GTAGTTTCCAAAGACGCAGCGGATTGGCTCATATTTTTTTTTCTTGCGGCGACTAGACGAATTCGACGATCATTGGTTGAAATGCAACGAAATTTACGCA
GTAAGAAATCGCAGCCTTCGTAAAATACCATACCAGTCTCGTCTCCGCGCGATGACGCGGTTGAAGCTGCGTACACGTCACTACGATGGCGACGCAAGCT
AGTTGCCCTGGGTTAGCGAGGCAGGCAGCCTGCCGCAGGCTAGCCGTGGTCTGTGCGGGACACGTCGTATGGACGTCTAGTGCAGTGGGGAAAGGTAGCT
TAGCAGAGGAATAGATAGACCAGAGAGTTGAGTTTACAAGGCTGGTTAGCAGAGATGAGCGCTGAACTGCTGTGCGCTTGGCTATTATGAATTGTGAGTT
TTACTGATTTGGTCTTCCATATATGCATCTGATTGGGAAATCCTATGCCTGTCTGTTCCCGCTCTATCCATAAGCACCAATGGGAGTAAATATCTCTGTC
TCACTATGCCGTTGACCGATTTACTCATCCAAAGAGACCCTGGGGTGAATTTTAGTTTTTGGCGCGAACCTATAAAATGATCACCTTCCCAAACCGATTG
GTATTCCAAATTAGAGTAATGAATAAATGATGCATGGCATCATAACTCTATTAATTTATGCCTTGAGACATAAAACCCATGCCGCTCGCAGGCCACACAA
CCGATTTTTCTCCCTCGCGGGGATGCCGAAGCGCGACCGCGATGAAGCGCGAAAAATGATAGAGAAGCGTCCACGTCGACGGGTGCGCCACCTAGCGAGC
GCAGCAAGCGATCTGGGCGGTGTCGTCGCATTCAATGACGTGTGGACATGGCTCAAGAAGTCTGGCTGGTATTCTAAACCGCCTCCCAGACGTAGTCTGG
ACCTGCGCTATCGCTACGTTCGACCGGATGGTGATGCAGACGGTCAAGAAGGCGTCGATTACCTTCTTGGCGAGGCTGCTGTTCTTCGGTATGCTGCCGC
CCTCACAAGTACGAGTCTTGCTTGTGTGAACGTTCGCGGCGGTGGTGCTAACGACGCATGAGGGGTTGTTATGTCATCAGGGGGCAGAAACGACAACGGC
AGCAACGAGCATGCCGAATCCAGGTCAAGAGTGGACGAAGATCGAGGAGGGCGCGAGCGCGGGCGAGGCAGTGATGGCCGCGATGGCGGACATGGCGTGG
CACCGGGTGCGTATCCGATTGATTCAAGAGTAGTGACTGCAGCTGATGATATTTGTGCGTGGTGGTGCGTAGCAGCAACAGGCAGTAACAAAGACGGCAG
CGGTAATCTGGCGGCATCCAGGCCAAGTGTGGTTGGAGCTCAAAACAAACGCGGACACGGTCGTGGCAGTGGTGGTGGCAGCGACGGCGGACGTGGCAGT
GGTGGCGGCGACGGCGGACATGGCAGTGGTGGCGGCGACGGCGGACATGGCAGTAGTGGCGGCGACGGCGGACGTGGCATTGTTGGCGGCGATGGTGGAT
ATGGCATTCCAGGCAGCGACGGCGGCCGTGGCAGTGGTGCTCGCGCTCGTGGACGTGGTGGCGGCGACGGCGGACGTGGCATTGCAGGCAGCGACGGCGG
CCGTGGCAGTGGTGCTCGCGCTCGTGGACGTGGAGGCGGTGACGGTGGACATGGTATTGTTGGCGGCGACGGCGGACGTGGCATTGCAGGCAGCGACGGC
GGCCGTGGCAGTGGTGGCGGCGATGGCGGACGTGGTGTTGTTGCTCGCGATGATGGATATGGTAGTGTCAGTTGCGGCGGTGAACGTGACATTGGTGGTG
GTGATCGTGGCAGTGGTGGCCGCGTCGGCGGACGTGGCAGTGATGAAGGACGTGGCGATGGAATGGGTGCGTAGTTGTCTTGTTGCCGTCTGCTGTTTAA
GCATTCATCATGTATGTATTAATATGAATATTTGTATACTTGTTGTAGTATCAAGCGCTGTTCCTGGGACGCCACAAGCCACAACTCGGGGCAAACGCCC
GACTCGTTACATCGGACCCAGCCAGCGAGGACACCTCCGATAATGCTGCAGGAGGTATACATGAATAAGTTGGTGGCATTCACTCCGGAGCGCGAGACCT
GGATGAAGTCCAAGCTCTACCGCCCTATCGGACCGGCATACATTGTGGGGCGTGTTTGCCGACGTCCGATGCGAGGAAAGTTTGCGTCACTGTTTGAGAT
CCGCTGGCTGGATACTCAGTTCCAGAACGCTGTGGAACATGTGAGTGTCGGATGTGTTCAATCTGGAGTGGAGAACTACAAGGAGCTTACCCGGTTGAAG
GACAACCCCGACTGGCAAGGGCTAGTAACGGGTGACGCCGACGATGACATTGACGTGGATGATGACGACAATTTGCAAGTGGTGGAAGAATACAGAGAAT
TTGATCCGGGTGTTTTGCTTCCTGCCAATATGGAAGAAGTCGAAGCGATTCGAAATCTGCGATTTGAGCCCAACGGAGAAGTTGACGCGCCGACTGACCT
CTACCAGCTTGCCGACGGCTCAACGAAAACGACCCTTCTACCACAGTATAAACACCTGTTTGAACACTCGGCCACCTCCAGCTTTTTTGCGTACCTGCCT
CTGTACTTCTGGCGCCAAGTGCTGTTTGAGACGAACAAGTATGCTATTGTGCACGACATCAAAATTGGAGCACCATTCACACTCGCGGAGCTGATGGCGT
TCCTAGGCATCATGTTTTATATGGCCTTGAACGACAAAGGTGAATATGCGAACTACTGGGGCCAACAACCAGAAGACCTGATATTTGGTGGGAACTCCGT
CTCGCTGGATAGCGTGATGTCTCTAAGTCGCTTCAAACTTCTGCGGTGCTGCCTGAGTTTCAATGCTGTACCGACCACACTGGATCGTGACGCTGCTGCT
CGTATCCGACCTCTACTAAACTTGCTGAAAGTGACTGGTGGTCTCTATGTCAAGGTTGGACGTAATGTGGCTTTGGACGAAGCCAGTATAGCGTGTCGGG
CTCGACAAGGAAGGCACATGATCGTGTTCAATCCCATGAAGCCAACGGGTAAATACCATTTTCGGTTCTATGTTGCCTGCTGCTCATCTACCTGGATCGC
TCTAAACTACAAGCTACATTGCAGTAGGTGTGATGTTGGCGACCGGCTCGATGGCGTAGTTGGACAGGAAGAAGCACTGTCGCTGCGAGTAGAATTTGAC
AAGGTGTCTAAGATTCGACAGCACGTGTTGGAGGTCGTGAGGCCATTTTTCGGTACTAACCGCATCATCAACATGGACAATTACTACACTTCGGTCCAAC
TGCTTCAAGAGCTGAAGCTCAAGGTCTTTACGGTCGAGGAACCATCAAATCTAACAGGAAGCACTTCCCTCGTCACACGATCCTGGATGATTCTAAATGT
ACGCGCGGCGACCTCCTCCAGGCCATCTCCCATGATTATAGCATGATCGCTGCGTCATGGTGCGACGGCGACATCGTCAACATGGTGTCGAATGCCGACC
CATCTACGATTACACCTGTTACAAGAATGGTGGGCAATTCGTCACAAGAATTTGCTGCTCCGACATGCATAGGTCAGTACAACCAGAATATGCAAGGGGT
GGACAGGTTGGACCAGATCCGAGGCAGATTTTCCATTGCAGATGGTCACTCCTTCAAGAAGTGGCATAAAAAACTTGCCTTAGCAATGCTAGATATTGCT
CGATCAAATGCGTATTTGACGCGGCGGCTAGCAGGAGTCGGTCCTCCTGCGCGTGATCCACATCGCGAATTTGTCATGGATTTGGCGTGTCAGCTCATGA
ATGGCAAGTGGATCGAAGCTCCCAGCGAGGGTCGTATGGTGTACGGAACTAGTTCACTAAACGATGTCGTGGATGTGGAAGGCGTTGTGCCGACGCCAGT
GTCGACCCCCAGCGCGAACGTTCCCGTCCAGCGATGCACTGCCGTTGCCTCGAAGCAAATTCACAGCAAGAAGAGCCGGAAACGACGCAGATGTGTTGTG
TGCCGCTGGGAGGATCGCTACCCTACAGAGGTAACAACATACTGCCTTACTCACAGTGTGTCCTTGTGTCAAGAAGTAAACGAGAAGCCCCCAACGAGCT
GGATGTGTCCACAGCAATCTTGGACATGTTGGGATAAATTTCACAGGTTTTATTTGCTCCAAGATCTGTTCACCGTGAAAGGTTACATTCGCAGGGGCTC
GTCTCTAGCTCAAGCTAAAAGCACTGCTGCTGAAAGTAATCCTACCAAGCGCAACCTACCTGAACCAAGCCCAAAGCCAGACGTTGTGCGTCAAATTATC
TTATAGCTTCTGTCGTCGGTGGGTGAGCTGCTGAAGCTGGCGCGATGCTGGCCAGGTTGTGCTGCTGCTGCTGATGGGATGGTTGTGCCACCGCTGCTAG
TGGTGATGGTCGGGATGATGGTGTGAATATGCTG