Description :
From Genome Similarity Track
Location :
Scaffold_38:1469- 2986
Transcript NameFunction/comments
Phyag_g961hypothetical protein PHYSODRAFT_481950

Sequence
1517 bases(100 bases per row)
AGCGCGAGCGGCTTCTGAAGCTCATTCTGGCCTCAAATACGAAGGGTGTAATTCTACTCAGGTTTGTTCGACACGCAACCGTACTGCCACTGACTGAATT
TTTAACTGGAGCTTGCTGTATTGTAGTGGCGATGTGCATTTCTCCGAGATCAACCAGGTCGTGTGTTCCGACGGAAAGAACAAAATTACTGAGATCACAA
GCAGCGGCATGACGCACAGCTGGATGGAATTCCACGTACCATCGATGACGTATGTTATGGCGTTGCTGTTCACTTACGCAAACTTAGTGATGCCGTGGGA
GTTCCGTCCGACACAGCAATCGTTCTACGGTCACCTTAACTGGGGCTCCATTGATATCGATTGGCAACAGAAGCCGTACCCTGTCGCTGTGGTGAGAACC
CGTGGCGCAGACGACCAAGTGAAGCTTCAGTACGAATTTGAGTCGAAGCCGTTCCATTCGGACTCACCAGAACAAGACGCTATTGAATGCAGAGCCCCTC
GTGCGATTCCGCGTTGGAAGCGACTGTTTTGGCATGGCATGTTCGTGGCTGTCGTGGGGGCTTTCTTGCTTTGCATCCCACTGAACGCGTTCGTGCTACT
TTGGCTGGTGTGGTTTTTCATCAAGAAGATTTACGCCATCGTCTTCCCAGCctcaaagaagaagacggagtAATTGTAGAACGGGGCAGTGCTACCGTCC
TGGGTTGGCGAATTACTTGAAATAGACCCCACATTTGATCACTAGCTAACGTTCGgcagtccaagctgcaactaATCGCATCAATGCTCGATCCAATTGA
GCACTatcgacgacagcaactctACTGTCGAATTTATGAGAAGAGGTTGGAGGCTATTGCAGCTCGCCAAGTGAGTTTATGTCGTGACAATGCACTGAGA
GAGGAGATTGAGATCAACATGAAGGTCTACGTAGCAACATCTCTACAGTGCCGATATCGCGGATGGAAGGGCCGTTGTATTGCTGctcgaaggagaagac
gtcACAACGCTGCCATTGAAATCGGAAGAATCGTCCGTGGATTTATTGgtcgtcgacgagctgctgaggAGAGACGAAAGTCGAGACAGGTGCTTCACAG
CCCCATCGCGCTGAAGTTACTGCTGGAGAGATCCACCGTGGTAAGGACGGTCAAGAACTGGCAAGAGTTGCTGGATCCACAGACAAATGAGTACTTTTAT
TTCCACATCTTCACGCACGATTCGCAATGGCTGCCACCCGACTCTTATCAAGAATTCCTCGTGTGCAAGTGGCCAGAGTGTAGCTTTATTGCCAAGACCA
TTCACGAGATTCATGAACATTACAGGACAATGCACATCTGGTACTGTCCTGTGTGCATGATAAAAGTTTGCACCTCGACATTCCCAACCTGTCCACTATG
CAAGAGCATCTGCAGCCATGACGCTGTGACGGGCGAGATTTTAGGCCCTGGTGATACCCAATTGCAGGTTATTCAGCAGGCGAAGGAGGCTAAAGAAGAG
CTACGAAAacaaagaga