Description :
From Genome Similarity Track
Location :
Scaffold_254:14681- 23717
Transcript NameFunction/comments
Phypl_g6016putative RNA helicase
Phypl_g6017putative RNA helicase
Phypl_g6018hypothetical protein

Sequence
9036 bases(100 bases per row)
AATAGTGTAGTACGTGTAGTATCCACAGGTAGGACGAGTGCAGCATAGCGAGAAAAAGTGGATTGCAAAGATGAAAAACTTGTTTTTGCACGTTATTAGA
TGGGGAGCGGGAGGCGCTGTATCCTCGCCAGTCCTCGCAGTTCGCAAACGCTGGACAACCTCCTCTACCCGATAGTCGCCAATAAACGTTTACCAGCGac
cgcggccgccaccgtagcctccacggccacggccgccgccacgaccaacaaggtcgcgcagctcacgAGGCACCTCCTGCTCAGCCTCCTCCATGATCTT
CACCAGGGGTCCAGCAAGACGTCCGTTGTTGCTAGCCGTGAAGAAGGAAATGGACGTACCCTTGTTGCCGGCACGTGCCGTACGACCGATACGGTGGATG
TAGTCCTCAATGTTCTTCGGCATGTCGAAGTTCACCACGTAGCGAATATCCTTGATATCAAGACCACGGGATGCCACATCCGTGGCGACCAGGATCTGCG
TCCTGCCGTCCTTgaactcgcgcagcacgtagTCACGCTCCTCTTGCGACTTGTTACCGTGGATGGCCTTGCAAATGTAGCGAGTGTTGCGTAGGTTGCG
GCTGAGCTCATCGGCACCGCGCTTCGTCTCGCAGAAAATGATGATACGGCCGCCTTCGTAGATTTCGCGCAGGTGGTCCTGCAGCGCAGTATACTTTTGG
TGGTCGTCCATGACCTCCACGATctgcttgatcttcttgttggcCGTCAGGTCCAGCGAACCCACAGTCACCTGAATGAAGTCCGTCAGGAAGTCGTTGG
CAAGCGAGACAATCTCCTtcggccacgtcgccgaCCACATCAGCGTCTGACGGTCAGGACGGATCTGGCTCACGATCTTACGCAGCTGCGGCTCGAAACC
CATATCCAGCATGCGATCAGCCTCATCAAGCACCAGGTAGGTCACACGGCGCAGGTTCGTCTTGCCCATGCTCAGCATATCGATCATACGGCCGGGCGTG
CAAATGCAGATCTCCACACCGCGACGCAGGTCAGCAATCTGGCCACCCTTGGGGACACCGCCGTACACGCACGTGTTCTTGATCTTGGAGCTAGCACCGA
ACTTGTTGCATTCCGACTGGATCTGCACAGCCAGCTCACGGGTCGGCGCAATGATCAGCACAATCGGACCGTCACCAGGCTGCAGGTAAGGCTACACAGT
TCATAAAACACAACACACAATGAAGTTAGCGCACACTATCGCACCACCAGACAAGCAATGTTGCATGATAAAGCAAACACAAGCGAGCGCCGAGGGATTT
GAGGTGTTCGCATGCTGCTTTTTTCTTCTGGCCATCGCCCACAACGCACCAATGCAGTTTTCGCACCGATCGAGTGTCACGCCAACGAGAGAAGAAAAAG
GCAGGCGTGCTCAGCCAACTGAAGTGTGTCGGTCGTGCCGGACCAAATCTGTCGAAGTCAGTCGGTGGTTTCTCTTTTGCCTTCGCATGCATGTTGCCAC
GCACAATTCCGCAGAAAGATATTGTGTTTCCACCAACTTGACCGGCACTCCAACACAGCATACTGCGATCCGAATCAACTGAAGCGACGAAAGACACGCA
AATGGCGCTTTGTGAGGACGAGATACCCCACAAACGCGCATCTGCGTGGATCGACCACGCTCCGAAGACCGTTTCAAACCCCACGCCCCACGCGGGTGTG
TCCCGTTCAGCGCATCCAAAGAGCGCGAGAACGACCGTCGTGTGCTACACATGACTTTGCTATCAACTCCCCTCagcgcaccagcgccgcggGAGATGCG
TCCACCAACGAACATAATCCTCTGAAAAGAGTCTGCTGCAGAATACGAACCTGTGCGTTAATGTGCACGATCGCGGGCAGCAAGAAAGCCAGCGTCTTGC
CAGAGCCCGTCGCCGAAATGCCGACCATGTCACGTCCAGAAAGCGCCATGGGCCAGCCCTGGCACTGGATGGCCGTTGGGCTGTCGAAGCCCAGAcgcac
cacctcctccagcacgtactCGGGGAAGGACGCCTCCTCGAACGACAGCACGCACTTGGGCACGCCCTTGCCGGTCACGATGATCTGATTTTCGCGCTTC
CACTTGTCGTAGTCCTCCTCCGAGCGCTTGGTCACGTCCGGGTGCTCGTAGTAGAAGTTCTTCTCGAAGACAGGCAGCTTCGACATGTCCCACTGGATGT
GCGTGTCCAGGTTGGAACCCaggtcgccgctgccgccgaagccgccgcctccacggccgcccccaccgccgtagccgccaccgccgcctccgtagccgcc
gccacctccgccgtagccgcctccgccgccgccacgagAGCCACCGTagccgccaccgccgccgccgctgtaGCCGCCTCCGCCGTAGTCACGACGCGAG
GAAGAGTCGCCGTATCGgtcaccgccgccgccgtacATGAtcaagagtgatggtcctTTTTACTTTTGCGCGCTACTGGTCGTTTCGAGGAATGAGCTGA
AGattgtcgctgctgagcgacaGGGAGAGAGCGATCGCTTTGGGCAGGGACGAGCGTTAACAGGCGCTTTTGGTTGGCTGCCGCGGGGCGGAATTTCCGG
CAATCAGCTGTCGCAAGCTGTGCCATTCGTAGAAAATTCGCACACCGCGCGCGGCCATTGGACAAAATAAAAACGATCTTTGCTCGAATGGCGCGAGGCA
GTTGACATGGGAATTGCATTTACGCATGGAGAGCACGCATGAGCCCGTTGTATTGTGCGCCTGTCGGCGAGCGAGCACGCGCAGAAAACGATGGGACGGG
GTCCTTGCCTCGCTCCGCTAAGGTTGGTTTTGCGGGGGGTAGCAATGCTCCCCACCGCTCTAAGCCCTCTACGCTAGGATGGTGCGCTCGTAAGAGGCGA
ACTGCTGGTTGGCCTCCGAGATGCTCACCTCGATCTTCCGCACGCCACGATCCTGCAagagacagcagcagtataATAAAGTTAGCAGGAAATATTTGCG
GAGCGATGGCAATGCATACTGGGGCTCGTGTTTCTTACCAGGAGTGCAACGAGCGTGAACGCGTCAATGAGTTGGTTGCTCTGTTCAAAGGACAGTAAAG
TTTCAGGCGTCAGCAACAGGCGGCTTGATAAATTAATGATAACCGGGACGTACGATGTAAAtggcgagctcctcggccgacgAGTGCACGATCGGCAGGA
GCGAGCAGTCCGCCTTGGGGAAGCTGAACTTCGCCATGTCCTCCGTCACAAGGTGTACATTCGTGCCGTCAAACGAAATCTGTAACGCAACACGACCGCG
TCAACATCTAATGCACCCTCCTCAAAACGtactgcaacaccagcaaccaCTACACGTGTGTAGGTCCTCCTTACCTTCAGAGAATCGCTGTTCATGGGCA
CAAGGAACGATTCATTCAGGTCCTTGCAGATGACCCGCGagatcttcttgatctcaCCGAAGTCCACCACGTAACCATCCGATCCAACCTGTCCGGTGAT
CGTGACGGCCAAACGGTAGTTGTGtccgtgcagcttctcgcggaATCCCTACGATACACAAACCAATCGTTACAACGCTGCATCCCTTGCAATCTACACA
TGCCATCTCACCACATACCTTGTACGCAATGAAGTGAGCGGCATTGAACTTCATGTAGTCCTTGGACACGTGCACTTTGAACACCTCGTTGTAGCCGCTG
CCCATGGGATTGGGCGTGTGCAGCATGCGAGTCGTCGGGGCCGCCACGGGGATCGCCGTCGGCACTGCAGGTGCCAcaggagcagcaaccgcagtAGCGG
CACTAGTAGgcgcgtcctccttcaccgtctgctgcgcagctcgcacGGGCGTCGAGGTGCCACTCGAGGGTGACGTCGCATTGCCCCGGAACGGTTGGAT
TTGCGTCTTTACGTCGTCTGGCGTCTTGACGCAGCCGCGCAGGTGCGACGCCCAGCGGTCCACATTGCGCGACGAGATCTCCTTGTCGCAGTAGCAGCAT
TTAATGACGCCCTCGGCGACGCCGCGCGTCACGTACATCTTGACGATGGCCTTCTGGTCCGCGGAGAGTTCCTTGCCCATGCTTGATCCACTGGaactgc
gtctgcgtctctTGGTCTCTGGCGTGGCTTCGCTTGGCTTGGGTGTGGGGCCCTGCGCTTCCTGTTCGGCGATTATtttctgctcctcctcgtcctgaTC
AACTGACAGCATGAGctcgcgggcggcggcgaccgaTGCTGAAGCACTGGTTCCGACTGCTCTCCCTCGGTGAAAATCACCGAGCGGATGCTGTGATTGG
TGGAAAATAATGTTTgtacgtgtacatgtacgttaCACAATTTAAATTCGCGaggctacatgtacagcttcACACCGGGCTCGTCCGCTGGCTGGCGGTT
GCATCGCTGTACTACGTAGACGCTGGAAGCACGCGTCGACGGCATGTCAATAGGATCATGAATCTTGAAAATGCGAAACAATGACACACAAGACTGATAG
GCGGAAATATATAACAATGCgtgacagcagcgcgttcactCGCGCACAACTTTGCGccacgctggcggcggcgctctATTGGTCGGAGACAGCACGCGGC
ACAACACTCAGGAAGAAGTTCATGCtcacgccgagcagcaggccgatCTTTTGCTTGCGAGGAACGGAGCggtcgagaagctgacgaGAAGGGAAAGGCA
AACGCAAACAAACGCGTTAGTAGCACGCTCATGAGGCGCcatcagcagcggcagcggtaGAAGTGGACATGACTCACCATCAGAAGCATAAATACACCAA
GCAGGAGGCCCATCAGGAACCCCCACAGAAATTCAGTGCCAGTGCCTTCGTTGTCTGCCGCCAGAATCGAGTTGTTCATGCCGTTCATGTCGATCTGCGT
GTCCATCGCAATGCGCGCCGTGGGCACAACATTGAGCGCTGCAATCGGACAATCACAATACGTAAATCAATTTGACCCAAGCAGACACTCCAATGAAAAA
GTAATCAGACAAGCTCGTACCGAACTCGGACTGCGGTCCTTGTGACGCCATCCACTCCTCTTCCAGGCGGTATATCCGGTCTTCACTGCTCTCGCCAGGG
ACACGCTCTGCCTGGCTGATGTACACCGAAAGCTGCGGGTAGAAGTACAGACGTAGCGcctggatctcctcgcgACTGAGTCGGTCCCGGAGTCTGTCAA
AGCCTCTCCTCGTGGACGGGTCATCTCTCTCCTCCGGTTCGCCATCCGTAGCTGCCACCTGTAGCATATCACAGACGTTTCGTGCTCCAGTTAAACGCTG
CAAAACCGTCTCCACCAAAATGGACACCGGCATCATCTCACCTGGTTGACAACCGCCTTGGGGGGCGCCGAGCTGATGGCGCAGTGGATGAAGTCCTCGC
TCTTGACCTTGCAGCTCTCGAGCGTGGTCTTGTCGTCCGACAGCATCTTGCCTTGGTGAATGAGCCGCAGGAACTTGCCCTCGGcgttggtcttcttctt
cacgagctccttgagctctcccacggtggccgagggcgcgatctccacgcgcagcggCTTCTCGCTGAGCGTCTTGACCTTGAGCACGATCTTGCCGTTG
TTGTCGTCATGGATCGTGATGCCCACGGCGTCCTCCGACAGCTACAAATAATAATAAAATTTGATCGAAGACAAGGCAATAAATACAATCAGACTTTTAT
CTTCAACATGATGCACGGACGTCGCACGCGCGGCGCCCTACcagcggcttctcctccgtgaTGCTCTCGGTGTGCTCAGGCTCCATCATGCTGCTCAGGT
CGATCGATAAGGCGCccgctcgccgtccacgaccgCTCAGCGCCGCTGCCCCTCGCGCTGCTATTTGATCTGTGCCGGTTTTTCTTCGCCCTCGGCTTTT
TTATCGCGGCTCGAGCCAGTTGGATCTCTATTCCACGATTGGAGAAAAAGACACGTCtatttcagccaatcaaCAATCGCCGAGCTATTGCAGACCGCAA
TTCAAAAAGTCCGCGCTATTAATGGCGTCGGGTGACGCCGTGCAAGTCGCTGTGCGTGTGCGGCCGCTAAGCGCCAACGAGGCGTCGCAAGGGTCGGAAG
CGtgcgtggacgtggtggacgccagcgtcctgctggccgagaagcagTTCGACTTCGATGCGGCGttgccagcgacgacgcagcaggtGCAAAGCAGTTG
GGTTGCTATAGAGTGACTGACAGGGGGATGGGAGTTGACGTGGCTCTGTTGGTTTTAATTGCATCAGGAAAGAGTGTTCTCCACGTTGGTGGCGCCGATG
ATTGACCAGTTCTTCGATGGCTACAATGCGACGGTGTTCGCCTACGGACAGACAGGATCCGGCAAGACGTGAGTGAAGCTTtgaggacgacaaggagcgG
ACTGAAAGTAACTGGAAGCTGATATTTGTGTGGTCTTCTTTTGGTATGAAGTTACACTATGGGCAACGAGTTTGCATCGAGTGTTGCTCCGACTGAGCAC
GGCGTCATTCCGCGCGTGATTGAAAATGTGAGAATTGTTCTTGTGTATGGGAGGGACTCTTGTACCTTTGGTGCTGACGCGGAGCCCTGGTTGCTTTTAG
GTTTTCGAGCGCGTTAGTGCATCCTCGAACCCGCACCATTTTGTGCTCAAGCTTTCGTACTTGGAGGTGTGTGGCTGCAATTTATTAACGTCGATCTGGA
GCTAGTGTGCTAATTCGTTTACGCTGCAGATACTGAACGAAGAAATCCACGACCTGCTTACAAAGTCTTCACCCGCTACGCCGCAGCCCGCCAGCACGGG
GTTGTCTGTacgtggcgatggagatcgTGGAATTGTCGTGGCTGGGCTTAGTGAACACGTCGTTCATTCGACTGACCAAGTTGCAGATCTTCTGCGCTCA
GGAGCATTGCACCGTGCCACCGCTTCGACTAGTATGAACGCTCAGTCAAGTCGCTCGCACGCAATTTGTACCATCCTCGTGGAGCATCACGAAGTCAATG
CTGCGGAAGGAGGCACGGAAACGCGATTTTCCAAGTTCCACCTGGTGGATTTGGCTGGGTCGGAACGTGTCCGTCGTACAAACGCGGAAGGAGCTCGCTT
CAAGGAAGGTGTCAATATCAACCGCGGGTTGCTTGTGCTTGGAAACGTCATTAATGCTCTATGCGAACGCAGTCGCACAAATTCGCTGACAGCTCACATA
CCCTATCGAGACTCGAAGCTGACTCGTCTGCTCCAGGACAGTCTTGGTGGAAACAGCAAGACGCTGATGATCGCGTGCGTCAGTCCTGCCGACGTCAACT
ACGAGGAGACCTCAAACACGTTGCGGTATGCGTCGAGAACACGGAATATTGAGAACCAGGCTGTGATCAACAAGGAACGAAGTGCTGAAAATGAGGTCAT
ATATTTGAAACAACAGCTTGAAATCGTGCAACTGCAACTTCTACAACAAACTCAAGGCATGGCAAGCGGTCCAGTCCGAATTGATGCTCCTCACTCTGGT
TCAGGCATGAGTACTCTAGAGGAGGAGAATCGCAAGTTGAGAGAGGAGCTTCTACTAGCAAACAGTGCCAAGGCCAAGTGGAGAAAGATTGCAGATGAGC
TGGCAAACAAGAACAAAAGAGTGGATGGAGAATCAAAATTGGGTCCGAGCAGACCGATTCACATGTCGATGCCTACCAAAACGCGCGTAGCGGGGATTGG
TAGTCAAAGCGATAAGGACGATCGGGGAATCAAAAGCAGTCATCAATCGCGGCTGGAGCAACTCAGGAAGTTTCAAAGTCATAAAGGGAAATCTGTCAAC
ACCAAGGAAACTCCTGCTGTGAAACGGAGAACTGATGGGACTGTGGCACCAAATAAGCGGAGCCGGACGTTAATGTCTCCGTCAACTAATACTCCAGACA
TCGGAAGTAAAAGCTTGAGCGCGAGGAGAGTTGCAGCACTACCTTCACCTGGTGAAAAGGGTGTAGCTGGTGGATCTGATGTTCAATCAATGGAGACCAT
CacaaagctgctgcgccaggtGATAGCATCTCATGAGGCGATATTTACTGCAAAAGAAGCAGTCCGGTCAAATGTTGCTGGCAGAAAAGCGTTGGCGCTA
GAAATTTCACGATTGGAGGATTTGTCGTCggaagaagatgccgagaACCTGACCAGGTTGCAGGATGACCTTCGCAATAAGACGGCTTGTATCCGCGTTC
TCCAGCGGAAGTTGGCGAGCGTCGAGAAAAATGTGTCGCTGCCGTCTGGGCTTTTTCCTGTGAAGGCTGATACCTGTCACGCTCTCATCCACCATCTTAT
CTTGACGGTGGTGGAAAGCAAGGAAGAGTGCATGACTCTTTTAAATTGCCGCTTGGAGCTAGATGCCGCGAATGCGAAAATCGTGGCTGCACAAGATTCT
CATAGCAAGAATACGCGAGAGCTACAGGTCAAGCTTTGCGAAGTGATGAAAGAGTTGCAGGTCATGCAGGATCAAGCTACAAAGAAGAAAGCAGCtaaga
agcggaagaagcggGAGTCGTATGAAACGATAGAGACGCTGTTCAGCAGtagcgaggaagacgaggacaaCAGTGGAGCTGACTCCGATTATGTGGATGA
TGAAGACCGTCGCCAGAGACGCATCAAGAGAAGAAGAGGTTACAGCACACCAGCGTCGAAAGTCTCGAAAAATGTTGATGTtatggacgagatcgacaag
ttgctggaaaccagcgctgcttcctgctgctcctgtcACGGCAAATGTGCAACGAAAGCATGCGCTTGCAAGTCACAGAGTCGTGTCTGTAGCGATGAAT
GTTCGTGCAATTCAGAGAAATGCCGGAATCGAACGGGAGGTGATCCCCCGGGTGATAGTGGTGATACTCCAAGTTCCAACCTTCACGAAAACGGTGAAAC
CACTGATCTGACAAGCAATGATTTGACTCCTTCAACTCCAAAACGGAGGCCAATCGATGTGTCTGCGTCTGAGGCTTTCGTCACGACAGTACCTGAAGTG
GTAGCCCCAGTTACGATTGACTTGATGTCGCCGTAA