Description :
From Genome Similarity Track
Location :
Scaffold_9:146799- 149274
Transcript NameFunction/comments
Physo_339875Amino Acid/Auxin Permease (AAAP) Family
Physo_525139Sulfate Permease (SulP) Family

Sequence
2475 bases(100 bases per row)
GTCGACTCGCTCGCGCCGCTTGCAATTCACTAACACTCCACGATCACTGCCAGGCTCCAAAACGCGGTGATGATACCGACCACGCTGATCGCAACGGTGG
CGATGCGGTCCATTCGGGTGGCGTCCTCGCTGCACAGCTGCCAATAGAAAACGGAGGGGAGAACCAGCGCCAGGAGCGCCGTGGGCACGAGCATCCACGC
GAACACGTCCAGCGTGCTGGGAGCTGTGAAATACCCCAGGAAGAGAGTGGTGAGCACCAGAATGGTCCGGCAGAGCACGCGCGCGGTGGTCTCCACTCCG
CCGCACCTTCCTTCTTGGTCGCTTGCTGCCGCGGGGCTGGAGGTCACGAAAGGCAGCGCCCCTGCGGCGGCGGCGGCTTCCACTGGGCTGCTACGGCCAC
TTCCGCTCGGAGGCTGCACGATCCACCGCTCGAACGCGCGCTGCAGAGGGAATAAGGTGATCGTGTACGACAGCAGCAGGTGGATGCTGTACAGCACGAT
GGCCAAGTTGCGCACCACAGCGTTGCGCATGTTGAAAAAGACCGGCGCCTGCAACGTCGCACCGTACACGGCGTATGTGACGCAGCAAATGGGCAGATAC
AGTAACGCGGTGGCCCCCAGCTTCGTGCGCGCCACCACAGAGCTGCATTGGCTCGGATTCGCCATCGCGTCATACAACGTAGGGATGAGCGAGTGGCCGA
ACAGCGCGCCAAGCAGCAGAGAGAACGTGTACGAGAGCTTCCCCATCATCGTCACATTCGATAGGTCGGGCGTCACGAATACAAAGTCGGAGTGCTCCAG
CGCAATCTGCTTCAGCGGGTACATGGCGTCGCCGAGAATGACCGACTCGATCCAGAAGCTGACGGCGACGTTCACTGCCGACAGCACCGCCAGCGCCTTG
AGCGACGGCACCAGCACTTGAAACCACACGCACACGGCCACCAGCATCATCACAGTGCCGAACTGCAGCCCAAGCACATCCACGAGACACGAAGACGCCA
GCGCCAAGTAGCCCGTGGACAGAATCAGAAATGACGCGTGCACCAGCATGCTCGTGACCACTTTGCCGGCAGCGCCAAAGCACTCCTGCCCGAGGTCGCT
GAACGAGACGCTGGTGCCTCTCAGCCAGCGCACAGTCTCCAGCGCGTCCACCAGCAGCTTGGACGTGTACGCGCTCACGGCCGCCGCCGCGACGAGCAGC
AGCACGCCGTACCAGTTGATCTCCACGAGCGCCAGCGGCAGACACAGCATCCCCGTGCCCGTGATGAACGACAGCAGGTGGTAGAACGTCTGCCAGTTCG
AGAGCTTGTTGGACGCGGAGAACGACACGGGAATGGCCACCGAGGGCGGCCAGGGCGGCGTCAGGTCTCCGGTCGAGTCCTTGTCGTTGCGGCTCAGCGT
GGTGCCGTAGCCCGCGCGGTCGCCGTTGAGCAGCGAGAAGGCGCCGACGGCGGCCCCGCGGCCGTCGAAGCTGCCCTCATAGCCGTCGTAGACGCTCGGT
GGATGCTGCGCGGGCGGCACCAGGCGATACGTCTCGAAGCTGCGGCCCATGCGCTCGCCGGCCATTCGGTCTCAGTGCGGGTTTCGTTGCCCGACGACGC
TCTGGGGCTGAAACGAATCTTCGTCCTCTCCGACGGGATTGGGAGCTGCTACCTTTGAAGGTTGACAGTAGTAAACGACTGGCAAGAGAGCTCAACGGGG
TATACACGCCAAGCAGCGCTGCAATGTGACAGGCACTCGGTCGGGATGCACGGAGCAGAGGTGACCAATCTGGACGAGCGATAACTGGGCACCGGACTGA
AGGATAGGCCGTGTGGCACACATGCGGCACAACATTCAAGCGACATTACATCGAGAGTTGAAGTTGAAGTAGCCTACTGTACGTCTCTCCAGCGGTAGCA
ACGCTGCGCCGCGCTCACAGCGTACACGGAGAGCCCCAGCATGAAGCCCACTCCAGTGTTGAACGCCAGACAGCCTGACGCTGTCACTAGCAGCAATAGA
AGCGCTGCATCACGCTCGCCTTCAGCCGTCTCGAGCTTCAGTCCCACAATAGCGAGGCTCAGGCCGCTGAAGACCAGCATGACGCCCAGCACGGACGCTG
GGAAGATGCCCGTCTGAAGCAGCGCAACGCACGTGGAGCCCAGCAGCAGCGCGAAGAACATCTTGAAGGCCCCGAGGAACACCATCGCCAGGCTGCTCCG
CGCACCGAAGGCGTACTGGGAGGCCAGGCCGCCCGCACCATGACACACCGGCAGCATTCCGAACCAAGAGAAGAGAAGATTTCCGCCGGCGATACTGAAG
CACACGCGGCGCACGCCGGCAGGTTTGTCGTGGGTGGGGAAGAGCTCAGCTGCCAGCGATTCGAGAGCGACTACCGAGTTCAACAAGGTGAGTGGCAGTT
GTGGCAGGACGAGGTACACGAAAGCCTGGCCAAAGTCGTGCATCGTGGGGACCACCGGCGCGACGAACTTCGGTC