Description :
From Genome Similarity Track
Location :
Scaffold_586:14679- 15816
Transcript NameFunction/comments
Phyta_totarag9460ATP-binding Cassette (ABC) Superfamily

Sequence
1137 bases(100 bases per row)
TCCAAAGGGTGAGTGCTTCGGCTACCTGGGCATCAACGGTGCAGGAAAGACCACAaccatgaagatgatgacaGGCGGTATCCTTCCGACCTCGGGCAGT
GGTATGCTTGGTGGCTTCGACATCTTGAGCGAACAACTGGAGGTACGCCGTCTGATCGGCTACTGCCCGCAGTTTGACGCTCTCTTCGAACTGATGTCTG
TCCGAGAGCACCTGGAGCTATTTGCTCGTATTAAGGGCGTGGCGCATGCAGACTTGAACGGCGTAGTCAAGACGCTCATGCACCAGATGAACTTGGACGA
CTTCGAAAACAAGTTGGCCGGCACCCTCAGTGGAGGTAACAAGCGCAAGCTCTCCGTTGCCATCGCTCTCATCGGATCGCCGCCCATTATTTTCTTGGAC
GAGCCCTCGACAGGTATGGACCCAGTCTCACGTCGCTTCATGTGGAATGTCATCGCTGCCATCTCCACGCAGCGCAAGGAATCGACGATCATCCTCACTA
CGCACAGCATGGAAGAGTGCGAGGCGCTCTGCACACGTGTTGGCATCATGGTGGGTGGCCGTCTGCGTTGTCTTggcagcgtgcagcacctgAAAAACCG
CTTCGGCGATGGTCTCATGCTCGAGCTGAAACTTATGGGAACACCCACACACGACATTGATGCTCGCGTGGCTTCCGTGTTCAGTGGTAGCGCTTCGACA
ACGACATTTCCGCAAGCAGAGCTGCGCGCGAAATGCGAGGCGCTTGGCGACGCGTCTTGGGCCGACAAGATTGCGATGAGCCACGCCACTGGGTACGCGT
TGGCGACAGCACTCGAACGTGACGGTACCTTGCGACTCGGCATGCTCTGCGCGTGGTGGGCTGCTGAGGAACGATTCTTGGCGCTAGATGTTTTCCTGCG
TGAAAGCTTCGCAGTTGACGCCAGCACCGGTGTGAAGCTACTCGAGCGGCAAAACGATCTCTGTCGTTACAAACTCACCGGTAAGGTGCCACGACTGGCA
AGCGTATTCAGACGCGTCGAgggcagcaagcagcagctgggcATCCGCGAGTACGCCGTCTCACAGACCACACTCGAGCAAATCTTCAACAACTTCGCCG
GCCAGcagagcgaggagaagggTGTGGCGCGCGGTAT