Description :
From Genome Similarity Track
Location :
Scaffold_69:146735- 149551
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_09996Hypothetical protein
Sappa_CBS223.65SPRG_20878Hypothetical protein

Sequence
2816 bases(100 bases per row)
TCGAGTGGTTGAGGCGATCGACAATGTCCTGCAGCAGCGTCTTCTTCGCCGCGGGAAATACGCCGGGAAAGCCGCCGCTCTGCTTCTCATCATCGCGCTT
GGCCAGCATGGGCGGCGTCGACGACGAGAAGAAGACGCGCGCGGGCGTGGCGCGTCGGCGACCGGCGCCAAGGATCGCGGTCGACCGCAGGAACATCGGT
CGGCTTCGAGAACAACTTGCTGGTCAAATCCGTAAAGCCTGCACTCTTGTCCGGATAATCGTTTTCAGCGCGCCAATCACATTGCGTGTACTCGCGCAGG
TGTCAATCAGGATCGATATTTTCCAAAGCATCTCAAATGATGACGAATATCTCCAAAGCGTCTTCTTTTCGCGAATTGCACGTCCGCCGGCCATCGGCCT
GTCGGCGCGAAGAGACGGTGAAGTACATGCTTGCTGCTTTTATATCCCTGCAGATATCGATGTATGCGATGGGTCTGCCACCGGAAACGCAGCGCATCCA
AGACAAACGTGGTCAATAAGCTTCGAAGGTTGACTCTGGCAACATCCCAATTCTGGTAACATCCCAATTCGGGCACACTCCATGACCAGCGGCATGTACA
ATGACATTTTCAAACGACTGCTACACCACAGGCTACAAAACGGTACTAGTAAAAGCTAAGGATGACAGCCAACTTGTCCACATCCCACACACGAGTTGAC
GTCGTGTTTGCACTGCAAAATACACTGTATCGGTCCGATCCAACTCCAATGCCGTGTTCGGTGCTGTTCGAAGCCAAGGGTACATGAAATAAGTACCCTT
GCCGACGCGGCTTGCATTTGGTAGTGTACTAGTATGTGGTGTGGGCCTACACCTGACTCGTGCCCTTGTGCATGGCCACGGCCCTCCTCATGCGCGCGGG
CACGGGTCGGACAATATACTGCTGCGTCCACTTCTTCATCCTTCCGAGTCAGCGATTTCGCGACGCATCGCTCTCGCTGCCGGTCCATTTTCGCAGGACG
ATCGCGGTGCGCGCAGGTTCAGCGCGATGGCGACGTGGCGAGCGGCTTGGGCTCGCGCACGGCTTGCCGTCGACGGCGGCGTGGACCCTGAGACAGTGCT
GGTAAAACTTTAACAAGGATTTGGTTGGTTCTGCATCGTGCGTTCTGGTTGGGCAGTCGCTTTTATTGCGTGTTCGGATGGCATCGGACCATCTTTTAAT
ACCGTTGGCATACAAAACCCAAGTGCATTGGCCGTTTGTGGTGGATAATAATATGATGCCGGGTGCCAAATTACTGGCTGGCGAGCGCAATGGCATGGCC
AGTATCCGGAAACTTTCCATTCCTGTTTTCCTGGGACCTTTGCCGAGCGACCACGTAGTTGACGACCATGAGTGCCACGCAAGAAGCGCAACTCGGTAGG
TGCTTTCGCCGGCGGTGGGCATGCGCGCTCATGAGACCATCTAGTCGGGGCTGCCTTGAAGGACGCGCTCCAGAGCCAAGTCGAATTCTACTTCTCCAAG
GCCAACCTCGCGACCGACTCGTACTTGGTGTCGCAGATGAACGCGCAAATGTACAGCCATATCGACCGACGGGCGCTCATAGCAAGCCTGGCTAGGTTCG
TGCCCATTGACACCATCCTTGGCTTTGCCAAGATCAAGGCCCTCAGCGACGACGCGGCGCTCCTCATTGACGCCATCAAGGACTCGCAGGTGCCATTACC
ATGATGGCCAACGCACAGTGCTGACACGACGATCTAGATTGTTGTCTTGAACGACGAGAAGAACGCGATCAAGCCCAACATCAAGTCGGAGCGCAACACG
ATCATTCTGCGTGAGATCCCGTCGGCGACGGCGCCGGCCGAGGTCGAGGCCATCTTTGCCGGCTGCGGTGCTGTCACGAGCGTCCGTAGCGACGTCGGCG
ACACCTGGTACGCGCCTCGACCCTTGACACATTCGCCTGCTCATGATGACACGCATTAGGTTTGTCACGATGGCCACGGAAGAGGAGGCTGTCAACACGC
TCCTTGCGCTCCGCAACAAGACGTTCAACAACGCGCCGATCAAGGCCCGCCTCAAGTCGGAGAACCTCTTCAAGTCGTTCTTCCCGCAGTCGACGCCGTC
GGTGGACGCGGCCGCCTCGCCCGTCACGACGTCGGCGTATTCGGTTGGCATGTACGGCAACGCCGGCTACTATGGCGCGCCCAACAGCTACGGCTACGCT
GGCAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGGCCTCGACGCCGAGCGGAAAAAAGTCCAAGGACAAGAAGACGACGACGACGCCGGCCACGACGGCCCAAGAAGGAGTCGGCCAAGCCCAAGT
CGGAGCGCCAGCCGATCCTGAACGCGGTCAACTTCCCGCCGCTCCCGACCAACGTCGGCGGCGCCGCCATCACGCAGGCGTACTCGCACGAGGACATTAT
GGAGATTGTCAAGCACATGGACGAAGCCGACTGCGTGCTGCCGGAAGGCAAGATGGATTTCGAGGCGCACGCCGCCGCGCTCACGCCGGATGCCCACCCG
GACCTCCTCCGCAACCAGCGCACGTACTCGATCGAGAAAAGCGCGCGAGGCGCTCCGCCAGGGCCGCCCGATCCGGTCCGACTCGGTCGGCTCGGTCGAC
TACGAGTCGATGATGTATGGCGAAGAGTAAAACAAAAAAAGCGCGCGAGCTCCGCCAGCAGGCCCAGGAAAAGGCCGTCGAGGAGGGCAAGCCCATCGTC
GCGGCGGTAAAAGAGA