Description :
From Genome Similarity Track
Location :
Scaffold_1481:1467- 3414
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1481-snap-gene-0.0Gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_1481-snap-gene-0.1Gene of unknown function
Pytap_DAOMBR444snap-pag1_scaffold_1481-abinit-gene-0.6Reverse transcriptase

Sequence
1947 bases(100 bases per row)
CATACGGAATCTGGGTGTTGGAAGAACATTCAGTGCGGTCGCTGCCAGCGAATGGGCCATCCTtCTGAACATTGTCGAGAGGTCTGCCAGGGATGTGGCG
AAGTCCATGACAAGGGCGACTGCAAGTTCGAGAAGTTCTTCAACGGGATTGCTGCGTGGTATAATCCAACCCGCCACGCACGTTTGCTCCCACCGGATCT
CGAGAAGGCTTTAAAATAGAACGCTCGCTAGCTACATGGGGCTAGAGCGCACCGAGCGTCAACCCGATGTCTGCGCCATCGTAGACTGGAGGAATGAGGC
CAATATACAAGGGAAGTTtGAGAAAAAGTGTGAGCGGAGTGTATGTGTGGGAGGATCCAACGCAGGAATCcGAAGGTCCACCcGAGATCAAGAGAACCCC
ACGAGTGAAGAAGATCCAGCTGAACCACAACGAGACCAAGGGCTGGTGGAAAGCAGTGCGTCCAGATCATTGGACGTATAAGGCGAAGGCCCGGGCCAAA
GTGAACGACCGAGATGCATGTGTATTGTTCGACTCAGGGGCGGAGGTGTCCCTCATCGATGCTGACTTTGtGCGCAAGTCAGGATTGAAGATAGATCGGA
CAAAAGCGACTACATGTGTCGGGGTTGGCGGTGAGCCTTATCAGACCGAAGGATCCGTGACGGTGAAAGTCACTCTGGCGAGCCAACTGGCCTATGAGGT
ACCGATGCTGGTAGGGgAGTTAGAGGGTCAAGACGCAATTCTGGGTATGGGGTTCATGGCTCCAGCAGGCGTACGACTGGATGCGGCCGACGGATCCGTG
TGTCTACcGGACGAAGTGTATGTGCGATTCGAAGGAAGCAAGCAGTTGTTCAGGTCCCACGCCCGCCCGATCTACGTAGATACAGTGCGGATCCTCCAGC
CAGGGgCGTACGCCGACGTACGAGCTGgTAaGGACCACGGTCAAGTGTTATGGATCTGCAGGTCTACGGCAtGGgTTACGAGCGTGATCAAGGATCGAGA
GGGgCGGATTTGCTGGATCCGTGTTACCAACGTCTCCAATGACGCAGTTGCTCTGAAcACCATGAATCAGATCGGTGTGTGGATGACCAAAGACACTGTG
CCCAGGAAGCCAGGGTTCGTGAGATCAGGGTCACGAAaGAGCGTTGAGTGGGGAAACCTCGCGCTGGAAGTTGGTACCGATCAGTCCGACCCAGCTACCG
ATGGAGATCCGGACCTCGACGAAGGCCCGCTGTGTGCAAGAAGGCGGTGTATCCACCGCCcaCAGCgaTCCTACCTCGGCCAACCAAGTCTCAGCAGGAT
CCTAACAGTCTCTGATGTGTCGAGAACTGATATGGAGGGCGCTGACGAAGAGGTCGTCATCCACGAAGGAGAGGATCCGCTGGCGGAAGACATTGAAGGG
GTCTGGCAATGATCCCTGAAGTTGGTAGGGGTTCTGAAGGTGCGGATCTCAAAGCCGAGGATCTAAAAGTTGGAGATCCTAATTGGTGTACAGCGGAAGA
GATCAACCAACTGCGACGGATTATCTGGCGGAGATCGAGCATCTTGATCGGAAAaGGCAACGCAATGCCGCCAGCGGCTCGAGGCGTGATTTGTGACATC
GACGTAGGTGATGCGAAGCCTATCGCTCAACGAGTTTGGAAGGTCCGACCGCAGTATCTGGAGCCTCTGTTCAAGCTGATCAAAGGCCTTTTGGTGAAGG
AACTGATCCGGCCGTCGAAGTCAGAATTGGcTTCCCCcATCGTGATTGTGTTGAAGAAGAACGGTGACATCCGACTATGTATCGACTACCGTATGGTGAA
TACATTAACGAAGCTGATGGTCTATCCGATGCCCCTTGTGTCGGATCTATTGGAGAATTTGGGCAAGATGATGTGGTACTGCTCCTTAGACATGACCagC
GGTTtCtGGGTCGTGGAGATGACGGAGCAAGCGcGTtCGATCTCcGC