Description :
From Genome Similarity Track
Location :
Scaffold_5:146690- 153727
Transcript NameFunction/comments
Physo_128554hypothetical protein
Physo_128555hypothetical protein
Physo_128556hypothetical protein

Sequence
7037 bases(100 bases per row)
ATATCTGTGGCACCAGCAAAATACTCGCCAGTCGAGCCGCGAACATGGCCGCTTTGATAGAGGTGGGAGATCTCCACGAACAACTTGGCCGTTGTGATGG
CTCGCACGAGAGTCATGGAGTGGGTTTGCATCCGGTAGACGACGACGAAGGACTAGGGCGATCTTACGTGTGCTCGATGTCTTCTACTATCGATCTGGGA
GGTCAAGAAAGCGGGAACTGCGCTGACCTGGCGCTCAATGTCCAGCGCTATCTCTCTCGCATTGTGGAGGAGCTACACCTCATCAGCGCGTGGAGCTCAA
GTATCTACCATCGACAGCAGCAGCGAAGTGACGCCGAGCTCGTCTCAACCAAAGGAGGTAGACGAATCGACGATAGCTCGTTTACAGCTATGGCGCAGCT
CGCGGTTGTTACCGACATCGAGTTGATGCGGCGCGACGTGGCAAAAGCTCAGCACGAACTCTTTCAACGGTGCACTACACAGATGGCGTACGTACAAAGT
GAGGCAACCGCAGCAATAAGCAAGCAGGATGCTCTCGTTAATGAGCTTCAGCATCGCGTGGACACCGCACAGCGCGCCTGGGACCAACAAGCGCAAGCTG
TTCAAGTGCTGGAAAAGGCTCGAGCTGAGAGCGACACCCAAATTCGATCTGTAGCATCGACGCTGCGTCAGGTGCAGCAGCAAACCTCAGCACATCCCAC
CAGAATCTCCGAGCTTGAGAAGTCTCTAGCTACCGTGACGACCGCGCAATTTTCCCACGATCAGGAGTTGCAAGCACTCCAACGGCGAGTCGAAAGCTGC
GAAACTTCCCATCAGCTGCAGCTTGAAAACACACGCCGCTCTGCTGAAGACTCGCTGACTGCCTTGCGGTCCTCGCACTCGCAGCTTTCTGCAAAGATGC
AGGTGCTGCGACTCGAGCTGCAGGAGTTGAGCGAAAGCACCCAGAAGCGACTGCAGCAGATGCTTAAATCCGTGAACTCAGTAGCGTCGAGCATGTCCGG
AAAGCCGGTACTAGGCCCTGGTGCTGCTGTGCCACCACGAAGACCCTCTGTAGCGACCCCAAGAACGCCCCGGTCGGGCGGTAATACAGCGTCGATCCAA
CTTTCACAAGGTGGAGCTATCAACAACTCAGACGATGGTGGCAATAGCACGCAGACGGTGATGGCCACGGGAGCGGATGCAGTGGGGACGAGCGACTGCT
TCATCTACGCGAAAGCGGCGCTGCCCCACCGCAAGTCTATCGCCGATACGAGTTCATTAATGAAGAAGTCTACTGCGCCGTCGACAGGTAGCAGTCGAGG
GCTAGTAGCCTCTGGTGGGATCAGCTCAGCTTCATCAAGTGTAACGGACTCGAAGACGAAGGACGGCATGACCAACTTGTTGACTGTTCAGCAGTCAGTC
ATGAGCGTGCCTTTGGGCTTCGAGGACGACACAAGGCCCCCTACACTCATCAATATCCCAGCAAAAGGCAACACGGACCCACGAGATCCGATCATCCCAA
CGCGGCGCACTGCCCATCGACACAACAGCCTCCCAGACGTGAACCTCTCCGTGGCACAGGGCGCACTTTCGCCGCATAAGTTCCAGGCCTCTCGACTCAA
CACCAGGCAAAAGTAGTGCGGGCCTCGAGGCGCAAGTACTTTCTCGTCGGGCTTCGAGTCTCACAGTCTCCCAGTCGCCGCCACAACAAAAACCACCAAG
AAAGACGACAGACAGCAAACCACGCGAGCATGAGTATGAACACTCCGGACACCATCGGCGCGGCCTACGACATCGCCACTCCAGCCTGCAACTACGAGCT
CGCAGCGCGTCGAGCTGCTGACGGGATGACAACAGCGTCGACGGTGCGTCACAGCTACGACAGTTCCCCCGCCGCCTGGACTTCTGACCGAGAGCTGCGC
CCGACGTTCGAGACGTGCTCGCGTGCCATCATAGCCGCTGCCGAGCGCATGGTGGCGCTCGCGCGCGAGCCCCGAAGCCTGGCCGTGGCCATCGCGTACG
ACGAGTGCCTCGACATCATCACGGCGGCGGTGAACCACATGGAGCAGATCGAGTCGCGTGGGGTGCTGCGCGAGACGATCCTCGAAGCCTACGGAGCCAT
GCACAGGATCCGCGAGCTGCTGCGACCAAGTCCGCCCGTGCGTCGAGCCCTGCGGTTCTAAAGCCCCCAGCAAATACTCAACAAAAGCATTCATTCATTT
ATTGAACCTTATCGCCTTCTTTTGGTCAGCTACCGCTCAATCCGCGCTGCAGACTCGAGGGGTCGAGTGCGAAGGCCTCGGCCGCCATCTCGAAGACGTT
CTTGACGAGCCCCTCGTGCACGGGGGCGAGGCTCAGCAGGTTGTGGACCTCCCGCCCGTCCTCGTCGATGAAGGGGAAGTACAGCGCCACACGCTGCATC
TCGGAGCGGATCCAGGCCTCGACCTCCGGCATCAGCCCCGGGGGCACCGGCAGGTACCAGCGGAAGCCGACGTCCCCGTACTTGCCCATGTGGTTGGCGT
CCGTCACCTGGAGAATGTCCTCGACGAGGTCGGTGGAGCCCCCGAAGACCCCGACGAGCGCCTCCATGCCCCAGTCAGTCTCGCCCGTCACGGCCGGCAT
CGCACCCCCCAGCAGCCAGGCCAGAAGATTCCTGAGACTGCAGTGGGGTTGACGTCGCTGTCGAGAGCTCGCGTCAACATGGCTGTATACTGGTGTTATT
AGCTGCAGGCGGCGCATCACGATCTGTAGAAGCATAGGCCTCCACTGTTGGGATGAATTCACGCTTCTCGGTTTTACAGTTATTTCGGTCTAAGCATAAT
ATCCATGGACACTTTCTTTTGACCCGCGAGATCCGTGGGTTCGACGACCTAATCTTCAAATGCCTGTTGAGGAGCAGAGTGAGGTGTACATGTACATGTA
CTGGCACGTTGTTTTGAAGAGTGATGGTATCATAGTTGAAGCTTTTGTGACGCACAGCTTGTAGACGAGCGTAGACAGGCGTAAGATCGTATAACCCTGC
TTGGCGATTGGCATCGTTCTCGGCCAGCAACATGTATAACAAGCAGTATTATAGCTGAATCAGCCTTGACTATAGAAGCAGCAGCACCACTTGATAAATG
CCAATGCGAAGCAAGTGCTCACCATCTTCGCTACTTCAGAATTGAAGTTGGCAGATTCTGTATCCTCAAGCCTACCGGTACCTAGGCTGCAGCGCTGTGG
TCGAATGTCAGCAATGGCGTCGCCCGACTCAAAAGCAGAATCAGGCTCAATCTCCCCGATCACAGGCGCCGAGCCTGTAGCAGACTTGTGCGAGCGTACT
CCAGCGCAGCTCTGCTCGGAGGCAATCGAGAGAAACGCAGTCCATGTGGCGCCTCTGACTCATGACCGCCGATACTATGCATGTAAAGCATGCACCCCAT
GCCATGGGCCATGGGTGACGGAGGGCATGAGAGGCTTGCGTGTCGTCAAGGGTGGTCGTGGCCAGAGTTCCTTGCAAGCAAGATGGGGAAATGGTTGCGC
AGCTATTGCTGCTGAGTGCGGTCTCACCCTGCACCGGAATAGTTTCTGTACGCCTTGGGTGCTCGCGTCCATCGAAACGATCCTCGTCCAGCGTGGCGCT
TTGCCGACACGCTCTCGCTCGTCTTGTCTATTGGGTTTGCGTTCGTGACACGGGCAAAATGAAGCTGCCCCGTTGGTCGCGCCGTGGGAGACACAACGTC
CCTCTTGGACGTTTCGAGCGATGCTACTGTCAGCATGTGCGTCTTCATCAGCCCTGACGTCTTAACGCCTCCGAGCTCCGTTCACCTCATTGCACTTTTG
ATTTGACCGTCTTCCGCTCGAACTTCATTACAAGTCACATCGCTGCTTCTGAGCCATGGGCAATCAACCGTTCTTCACACTCGAGGACTTCAAGATGGCT
TTCAGCCTGTTCTGCTGTATATGCGGCATTGGCACGCTCGGCATGCCCGGCAACTTCGCGCGCACTGGACCCGTGCTTGGCTTCTTCGCCACGGCCTTCA
TTGCTTTCGCTAATATCTACGCGTCAGTCTCCATGTCCAAGGTTTTGCTGTTGGCGCCGCCGACTGTCAAGACGTTCAGCGACCTGGGTGGATGGTGTTT
GGGCAAGACCGGCCGCTGGCTGGCTGTTATCTCAAATGGGCTCGTGTCTGCTCATCCCGTGCGTCTTCCTCGTTCTTGGCGGCGGGCTGCTTGATGGTCT
CTTCCCAGGCGCATTCAGCCCCACAGTTTGGATCGTTCTCATGACGGTGACGGTGCTACCGCTTTGTCTTGTGCCGACGCTCAAGGAGGGAGCAGGCGCT
ACGTTCGCGGGTTGCATGGGCACGCTGGTTGCAGACGGTCTCGCCATAGCGATCATCGCGCACGGGATGGAGGGCCACCCTAGCATTCCAACACCTGGAC
TTGACCTCGACCAAGTCATCGGCGCGTTCGGTAGTCTTTCGCTCGGTTACGGAGCCGGTATCGTGCTCCCGGACGTGCAGCGCCAACACAGCGAGCCAAG
TCGCATGGCGCGCGTTGTAGGCGCCACCATGATATTCATCATGTGCATGCTCATGGTTATCGGGATGGTGCCGTACTTCTCCATGGGCTGCCAAGGCGGG
GGAAACATCCTGTACACGATCTACCCCGACTCGACCACTGGTCTCACTTCGGTTGGCTTTGCGCCGAAGTGGGCTCAGTGATCGCCTATCTGGCAATACA
AATGCACATTACGATCGCGTTCGCTGTGCTGCTGAACCCAGCCTTCTACATCGCCGAGCGGTTGGTGCTGGGCATGCACCAGCAGGCCCCGGAGGATGTC
GAGAACGGTTTGCAGTACCAAGAAGCTGGAACGCCCGTTGCGCGCGCGAGCATCACGTCTGAGCGTCGATCGAAGACGTCCTTTGTGCCTGTTGCTGCTG
GTCACCAGCCTACCAATTCCCACGAGGCGGAGGTTGCTGAGTACCGTGGTGCTAACGCGATCAAGTACGTTGTGCTGCGCGTCACCATCGTCGTCATCTT
GGTGGTGCTGTCTATCATCTTCCGGGATCACTTCTCCGACTTTGCCGATTTCGTCGGAGCGTCCGCCATCACGGCCAACTGAATCCTGCTGCCCACGATT
TTCTATCTTATCAAGACGTGGATTTCCAAGGATCGTCTCAGTGGGGCTAAGCAATAGTGTATTGCCTCGTTGCCTGGGAGTGGCGTGGAGGGTTAGCTTG
GGACTAAATCTAAGAGTGAGCAGGCCTGAAGGCCCCCTCCTCTACCTGTCGCCTAGTCGTTGTCGACACGAACTGGCGCTCCTCTTGTACGGGTAAACCT
TGCCTCGAAGATCCGGAAAAACAGATTCCCGTCGCCTGCGTCGCCGAGTAATCAATCATTTCCAAGGATCATCTCAGTGGGGCTAAGCAATAGTGTATTG
CCTCGTTGCCTGGGAGTGGCGTGGAGGCGCCCCATCATTGAATCTCTCCACGTCGATCACTGGCAGCGTTCACGACCACTGCAACTTCGCGTTCATCAAC
TTGAACGACCCAGCAGTACCTTACCGCATCTCTCCATGTCGATTACGGGCACATCAACTTGGACAATCCAGCGGTGCCTTCCGAGGTTAGAACGGGATAG
TCTTCGAAGCAGGAAGAGAGCCAACGCCCGAGCATTTTAATCACTAATCGGTCTGCACCAGCATTCAGCAGCTTGGTTGCACCGCCGATCCGCACAGAGT
GAGTTGAGAATCGAGAAGCATCGAGACCGGCCTTGGTAGCTGCTGCCTTGATTATCTTAGCGACTTGGCCGGATGACACACCGCCGGAATCGCCCATCGA
GGGCTGGTTCATCAGGCCTTGTTCCTAGTCGTTTCGCCGCCGTCTTGATCCAGCGTGCAGCTCGCACGGGGCACAGCATAGAGTCCCCCGAGGCGTGTTG
AAATCGAAACTCTTCTCTTCCAAACTGATTATTCTTCGCTCCCCGCAGTAGGATACCCACGATCGAAGCCTTCCGCGGCTTAATGGCCTGCCCTTCATTA
TCGCAAAACTGAATGTCGCCGAGTCGAAGTACGAAGGGGTGAAACTTCTTGCCGATGTAGAGGTACTCTGACCGACGCAGCAAAAAGAAGTACGCGAGCT
GTAAACCACCCCACAGGAGCTGATGCTTAGGTCGGTTGATATCCAACAGAGTGTAGATTTGCCGAAGTAAGCTCGGCGACAGCGGTTGCTGCTTGACAAC
CGGATTCGTGAAACGACGAATGCCGCGCAGGAGTAAGGCATGCTGAGCAGTAACTCCAGGGTCATATCCATGTTCGAAACGATACCGCCAACGCCCTGGA
GAAAATCCGAACGCGCGTGGTCTTGGGGTCCACAGAGAGTTGCGAAGCCATCCAGAGCGAGTTCAATGTGGCCCACGAGTCTTACGTGCAAGTGCAGAAC
ATCATCTACGAACGACAGCTTGCGCGGCTCGAGCAGTCACACGGGGGCTCTCACGGCATCTCCAAGAACAAAGCGAGCCACCGTCCTCGGGGGCGAGAAG
GGGCCAAGGGCAAGCACGTTCCAGAGAACGTATTGGCCGCTCTACCCAGTCAGAATTGGAAAAGGCTGTGCATGAGGTTCTTGGCCGTCGAGAGCTGTCG
TGGGCGTGGTTCACAGTGCACATTCAATTACCGGGGCCACTTCCGTCCGCAGCAACTCCCTGCAATTGTGAAAGAGTTCATTGAGGCCAACTACGGCGGC
CTTAAACCGGAGTTCAAAGACCTGTGAAGGTGCTCGGGCGGGGAGTTCTCGGGGGCGAGGTGTGCGGGCTGGGTACTTACCCCCCCACGATACTGTGATT
CATCGAGCCGGTGCAAAGTGCTCTACCAAGAATTCTGGTGCCGGTGTAGTCACTCGCACATCGCAGCTGCTGCACTCTCGTTCGCCATCGTCAACGGTAG
TACCGGCGCCTATTCCGGTGCAGATGGAGGCGCTGCACTCCACGGACTCGCGTACGCCTCCGCCTTCGGTGCAGTCACGTCTCCTGTCTATGCAATCAAA
GATGCCTCCGTCGGCGCAGTCAAAGTCGCCACGGTCG