Description :
From Genome Similarity Track
Location :
Scaffold_2:14665- 30279
Transcript NameFunction/comments
Phyci_88941Hypothetical protein
Phyci_88942Hypothetical protein
Phyci_88943endomembrane protein 70-like protein, putative
Phyci_75789conserved hypothetical protein
Phyci_100279Hypothetical protein
Phyci_88945hypothetical protein

Sequence
15614 bases(100 bases per row)
TGTGGGTTGGCATTTCCGTTGGCGTTCTCTCGTCGCCTCTTGGCTTCGGCCCCAACGCGCTTGAACTTCTTGCTCTCCGTTTTGTTCTGGCCGCGATACT
TCTGCTTATCCCAGCGAGACATCTGCAAGGAGTCACGACACCCGGCTCCGCCTTCCCAATGACGAGAGGTCGTCTTCTTCGCCGCAACATCATTGCCGCA
AGAGCACACTTTCACGGAGCTCGACTGTTCCTTCGAGCATAACCCGCATATCATCCGGCTAGCGAATTTCCCCAGGTTAGCTTCGGGGCAGTCACTTGAA
TCGTGGCACACGTCACACGGGAAAGCTTTGCCGCAGCATTGGAACCGAAACCAGCGCAAGGAATGCTTGTAATGATCACACGCGCCATTGCGAGGAAGCG
GTTGGCCCAGCACAAACGTTTCCGTGACTTGCGCAGCTCCTTTTTTGCTGCCCTTAGCAACATTTACTGCGGAACGATCGGGCGAGTTGCTTCGCTTTCC
GCTTGATCCTTCCAGTAGCCCAGCCATGAAACGCTTTGCCATAACAGCTAGCTTGACGTGGCAAGAAAAACAGGCTTGTTCCGACCGCTGCCTCGGCGCA
AGCCTCTGCAGTAATGCCTCGCACGCGCACTCCAGACAAGTAGCCAACATATCGGACGGGAGCACATCCACGATGGAGCAGTTCTCGGTATCAACGTAAG
CTAGCACATTGCTTTGCGAGTGGGCAAACACAGGTCTCATGAGCACGTGGTGGAGCACGCTGCACCGTGGGCACCACTTCTGGATTTCCGCTGAGTCTAA
ACTGAGGATAGCGTCAAACTTAAGGGGGCAGTTATCGCACTGCACCTGGCAAACGAGTCGATGGGCAACGAGTGTTCCAACTTCGTGCAGAAACAGATCT
TCGAGGCAAATCTGAGTGCCCTTAACTTCAGGCTCAGTCTCAATCGTCACGCGCTTTTCTGGAGGAGTAATCTTCGCGTTTCGGACAAACGCCTCGCTTT
CTGCTGCATTAGTTGCTTCCTTTTCTTCGTGTACTTGATCTTGTTTTGGTTCAATTTTTGCTCCGGCAGCAGCAGTTGGATCCACGCCACGCCTGACAAG
GTCGCATAACATCTTAAATCGGTCAATGCACTCGTTCAATGAGCGACCTTCCACTTCACTGGCTATGCTAGTCCAGCGTTGCTTTTTGTCCATTGACGCC
GGGTACTTTTTCAAGGCCAAATCAAGGGCACGCTGTTGTGCTTCGGACCACTCACCGCTATCGTCACCTTGATAAACAGCATTCTCAGCATCAGATTCCT
CTACTGTTGTAGTCACGACCTTCACATCTGCTTTGACATCCTTTGATGCGCCAACATTCTTAGTTGGGGCACCCAACTGCACCACAACAGCGCGCGGTGG
GAGATCGGATTCCGCTTTAGCGACGCCAACAGCCTTGATCTCATGAGAAAACTTGCATTTATCTCCATCGCGGCATTTGTTTTGTGCGAAAAACTTGCAC
TTACGTACACGCGTCTTCTTTTTCTTCTTCGGCTCTGCTGCTGTTCCTGCTGCATTTGACGATTGAGGCGGTTGCGCTGGGTCGGCCTCCCTAACGACCG
AGGTGGCATCCGCATCACGCGGATCCAACGGTTCCCTGTCATTCCCTTCGTCCTCTTTTCCCTGTTTCGTCACGTGTGAGAATTTGCAGTTTTCGCCATC
TCTGCAGCTGCCTCTAGCGAAAAAGCGGCACGGTCTTTTTCCGCGCCGCCTTTTCGGTTTCTTCTCAACCGAGGCGGATGCTTCTTCTTCACCCGCACGT
TCATTCCACTCATCGCCTTGGTCACTGCTACCTACCAGAGGTTCTTGCTCTTCCTCCAGCGCCTTCTCGAACGGTTCAATGATCCTCCAGAAGTTGTTAT
CCACCCACGTCAGCAGTTTCCGCAGCGAGAAACCTCCGCGCAGTTGTCCAGCCCGCTCGTTCACTGCTGCATTCAACGCCTCCACCTGCTCGCCGGACAG
TCGGCCGCTCCACTGAGCGAAATCCATCTGAGCGGCCTCCGTCGGGTACTTTCCGGGCAGCATCATCTGCAGCTCCACTTGGCCCTTGAGGCGCGCGGGC
AGCTCCGGGTCCGACAGGCTCAGGAACAGCTGCACGCATCGGTCCTGCGTGCCTGCGTCCTCGCTCGTCAGCTTGATGTGGTAGCGGCGCTCCAGCGCCA
TCCACTCCTTCTTGGCGGCGTCCGTCTCGCTCGCCAGCGCCTCCTGCCAGCTCGGGTCCGCCATCGTCCTTCTCTTTGAAGAGGCAAGTTCGAAAATGAC
AAGATCAGCGAACAGTGAACTGTGATTGGCGGAGAATGTCACCGGAGAGACCGTTCCCAGAATACTCGACCTGGAGAGCTCACTATTCGACCCAAACGGC
AAAAGAAGCACGACCATGTGGAGCGTGCGCCTGCGCGGGCCTCGCGGCAAGCAGGTGGTGCTCAAGATCGACCCGGACGCGAGCTTCAAGGCATTCTCCG
GTCCGTCCTCTGCGTGGCTCAGCTGCTAAGTCTCAGCGCTGCGCTGGTGTCTGACTGCCGTGCTCTGCAGAACTCGCTGCCAAGGAATTGGGCTTGAAAG
CTAAGGACTCGCCAACCTGTACGCTCCTGTCTCTAACCTGCAACGCCGGGTAATAGCTCTAATAGTTAGCGATACTTTCGGCTTGTGGGTGTAGTTCGCA
GAGGGTTCCCGCCTCGGGCGGTGGAGGTGGACGGATCCGCGCTGGTCAAGTCCGTGTTCGAGGCCAACGACACTGTGGTAGTCGACACGAATTCGGGTGG
TGCAGCTCCAGTTCAAGCTGCTGCGTCTAGCACGAAGAAACCGGCTGCGAGACCAAAGCGAGCGACTGCGAAGAAGCCGGCCGCGAAGGCTCCGAGAGGG
GGCGTGCACAGTCTCAATCCGCCGACCACTGCGAAGAAGAAGGCGCCGCCGAAACGGAAAATTACAGGCAGCGGACATCAACTGGGCAGCTCGTTGGAGA
GTAACCCATCCGAGGCTGCGGAGTCATTGGGGGCGGACAACGAGGATCAGGAGCCGCAGCACAAATACCGCCGCACCCGCGCGATCAATCTCACTTCCAA
GGAGGATGTCGAGATCAGCCTGGTGAACGCCGTAAGCGGCCAATCCAACGATCGGGCAGCCAAGTTCTTCCGTGCGGCGACGAAGAATGCAGTGGAACAT
CAATATGAGCTGACGCTGGCCACAGCTCGACTAAATGCAGCTCTTTCGCACAATTTTGAGATTGAAGAATTATCGACTGCCCGACGCGCTGATGGTAGCG
CTGCTAAATTGCGGGTGCGGTTCAAGGAGACGCCACGCAGGTGGAAAGAGGAGACGGTAGATCTCCTGAAATCTGACGAGCTTCAGGCCATTTTGAAATA
TGTGTTGCTGTCTGGTGGAGAGACTGGCCGTGAAATGCTGAAACCGTTCAACATGGCGCAAGTATCCACGAGAGTCTTTTGGAGTATCGCGCGTTTGTAC
GATGGAGATATAGCTGCTGGTCTGGCTGAGCTCGTGCCCGACGAAGACTGGTCGTTTTTGGACACGCGCACACGGTAAGCCACCTTTTTGAGCCATACAG
TACATTGGACACTCGTGTTTGACATCGGTATGTGTTATGACTGGTCTACGCATAGGGTGATGTCTGAGAAAGCTATGGAAGCAAAGGTGGAATTATACTC
TTTTGCTGTGGCAGTGCAGCTTGCTACCTTTGTCTCTTGCTAACCTGTGTGATATGTACTGTAATTCCACCATCTTGACAGGAAAATGAAGAACAGTACA
AGCTGTGGAAGCAGGGGGGTACTGGAAGAAGTCGTGTGTCGCCTCAGCGCGCAGAAAATAAGCCGGAGACAAAGACAACCAAGCGCCCGGCCGCCAAGGA
GAGGGGGCCCGAGATAATTGAAGTAGATCTGAGTGATGATGAAGCAGTCAAGCACGATGATGCGAAGCTAAAACGTGAACCTGTGAACCAGACCCCTGCC
CTCTCAGCTAAAGAAGCGACACCGAAAACTCTGCGCAGCGCAGCAGCGCAGGCTGCACTAGCTCGGTCTGATCGAAGTGTGCACACAAACGCCGTCGTAT
CTGCTTTTCTCCAGGAGGATAAGCCGGTCACGCAGTCTGCGATGAGGCCAATGAACGCTGATGGCGATGAAACGGAGTCTGAAGAGGAGCTGGAGGATGC
CACAACAGTTTACTGTGATACCTGCAAGAAAGCACGTATTCTTTCGGCAGAAGAAGCCAACAATGCTGAGCTTAATAAGGATCCTTGGACCTGTGCCAGC
TTGGGAAGGACCGGACGCAGTGGTGGGTGCGATGCTATCGATGATGAAGTCACTCAGATTACAGGCGCTCCGATTGCGGAATGGCTACGAAAGGCTAGCA
TTAACACTCGGCGGAACCTGGCTGACGCCTCGATAGGTTCGACGATGCATGCTTTGGTGAATCCGCTGGATCCATCCGCCGGGCAACTTCAAGCTAAGCT
TGAGAAGCTGATCGACGAGGTGAGTGGCTAATGTGTTGAACAGTTGACGTTGCTTTGATTTTAACTTACCGTGCTTGTGACTGCTAGGCGCGTCTTGATG
AGGTGAACGACTGGATGTCCGAACTTGTTGGTGGAGTTGAAATGGTGCAGCGGCTCGAGATCCAGAAGCTTGGTACGCCTGCCGATCTGATAGCTACGCC
GAATGACTTAATCCTCGAGGCTGTTGGCAGCACGGCCAATACGTCTCTTGATACGGTCAGCTCCTGGCAAGCGCACGCGCGGCGTTTGGTGGACCAGCAC
CCCTGGTTGGGAGAGTGGCGCACGCTGTGAGCAGCCATGGACCAGAGCTGCACATTAGTTAACAGGACAAGCGCTTTGAAACCGAATTGAAATGTATTTC
TCTTTTCGCTTTCAGGTTTGTCTTCTTCTACACCCAGCAGGAGGCGGCAACGGCGGATGCACGGCTCGATGAACAGGGGCTGCCACTCGTTCGCTCCTCA
TGGTGACCCCACTTGTCTGCGACCTGGGGCAACAACACCATCATCACCCTTTTGTGCGCCGTCACCTCCCACTACTTCTTCTTCGCGTCTCACTGCCATC
TGCTGACCGGAGCCTTGAAATGCTAACTTGATGACTAACTTAGTCGATCTTAATGGAGCTGTAGATCTTGCGAGTGAACCAGAGGCAAGCGAAGTAGCCG
ATAGTGCCCGTCAGGAAGAAGAACGTGACCGAGATCAAGAACATGTAACCGAAGTACAGAATGCCCGAGACGAACGCCGTGATGTTCAGCTTCGTGAAGA
AGTACAGGAACGAGTACAGGAACAGGTACACGGCCGCGGAGCCCGAGGTGAGGAATGAACGCCACCACCAACGGTAGTCCTCTGCGCACAGCTGGAAGTA
GCACATCACGACAGTCACCTCAGCGCACGTAGCCACCAGGATAAGCAGCACGATGAACAGGAAGCCGAACACGTAGTAGATCTGGTGCAACCATAGCGCC
GACATGATGAAGAACAGCTCAATGAACACAGCACCGAAGGGGAGAATGCCGCCCACCAGGATGCTGAAAGGCGAAGACAGGTACCACACTTGCTCCGGAA
TCTGGCGGGCGATCTGGTTGGTACGCACAGGCTGCTCAATGGCAGCAGCCTTAAAGCCGAAGTAGCTGCCGAGGAACACAAGTGGCACCGAAATGCCGAA
CCATAGAACGAGCAGCGCGAAAAGCGTGCCGAACGGCACAGCCTGCGACGAGGACTTGCCCCACAGCACGAGGTTCAGCAGGAAGAACACAGCGAACAAC
AGGCCCGGGTACAGCACGGCCGTGAGAATCGTGTTCTTCTTCCAGTCCTTGCCGTTGAACATCTTGTACGTGCGGGACGAGTGGTAGCCGGCGAAGCTAC
CCATGAACACGAAAAGCAGCAGCAGCGTCGTCAGCAGCGAGCCACGGTTGGCCGGGGACAGCAGACCCAGCAGCGCAATAATCATCGTAGACGCGCTCAT
GCAGCACACTTGGACGCCGGTGCCCACAACCACCGAGAACAGCATAGGCGAAAGCTGAGGCGGGCGGAACACGTCGCCGTGGACAAGCTTCCAGCCAGAC
TCCTCCTGCGCCTCCTCCGTGGTCTGCACCTCGTTGTAGCGAGCGATATCGCGGTGCAGCGTGCGCAGCATGATCATAGCGATCATACCCGTCAGGAACA
GCACGATCATGAGCGAGTTGATGATGGAGAACCAGTGGATCTGGTCGTTCGAGCTCTTGCTGCTGATAATGCGGTCCCAACGCTCCTCCCAGACGATGTC
CGACTTGACGAACTGCACGTCGTACGTGTAGAGCACGGTGGTCTCGCCCTCCGGGTTCAGGTACTGGTAGTTGCCCTGCGACACCTCCTCAATGTTGACG
AACTTGCCGCACGTGTCCGAGTCGAGCTCCTGTCCGGCCATCGGCTCGTTCTCGTAGCTGTGCTTGATGGAGGTGGGCACGACCTCGAAGCCGACGACGC
GCCACTTGGGCACGTCGCCGTCCTCCTGGGCGTACGGGTCCGCGTTGACCGAGATGATGATGCGCACGTGGTTGTACAGCAGGTACTTGCCGTCCTCGTC
CACCTCGCCCACGGGAAAGCCGCGCTTGAAGGATCCGGCCTGCTGCGAGTCCGTCGGGTCGCGGTACAGCACGGGTAGGTTGTCCACCACCCACTGCACG
TAGTACTCGTCCTTGATCATGTCGATGAAGGCCTTCGACTGGTCGGACGAGTACGTCATGGGCTTGCACAGCACCTGGCAGATGGCGTCCTTCTCCATCT
GCATGTTGTACAGCGAGTCCATGATGGCGTCGCCGGCCATGATCTCGCCCAGGTTCTCCTGCTGCTCGTTGGTGGCCGTGGGCTTGCAGAACGGCAGGTA
GTAGTACTCGTACGGCACCAGCGTCTTGGTGGACGTGATCTTGTTCACGTTGAGGCGCACGGCGTCGCCCGCGGCCCACGACTCGGGCGCCACGCCCGGC
ACGTAGAAGGCCGCGCTGGCCTGCTGCGCCGCCAGCAGCGCGGCCAGCGCCGTCACCGCCACGCTCTTCATCCACATCGCAGCTCGGAACggggagggga
ggggagaggaggggggggaggAAGGGGGTGGTTATCTGCCGCTCCGCTGCTCGGCTCGCTGGCTTCTTCGCGGTTTCGTGGCGCGAATGAGGGAGTGCGT
GGAGCGAGCTGCCACGAAGCCGCCAATCGGAAACTACTGCCCCAGTGTACCACTCATAAGGTACATCCTGACTACAATGAGAGAAGATGGAAGTGCTTAG
GTAAGATAGTGGGAGAGCACCGTTTTCGACCAATGCAGAGGCGCCACCTAGGTGGTGTGGGCCACATGGTTCCAGGATGCAGCCTGGTTTAAGCGTCCGT
CCACATCGCCGCGAAACCCTCTCATTTCCGTTGTTTACCGCCTCGAAAGGAACGCCTGGAGTTGAAGCGCGCCCGAGGCTGCCTCGTTCAAGCGCCGCCT
CTCGACGGGTGCGCGCATAGCCCACCAAGTTTGCTGCGTGCTATATACAAAGGAGCGGGTCGATCTCAGAACTGGAGCGCGACCCGACCCAACCCGTCCT
TCCTCCCCCTTCAAGCTGCCCCAATTAGCCCGAGGTCTGATTGGATCTGGAGTTCGTGGCTATTGTTGTCGGCCGCTCGTCCCCGCTAAGAAGGCCCGGA
CCTCCCAGTCGCGAAAAGCAGCGCCAACTGACGGAAAAGACCCCCTTCCAGCACTGCAGCGATGGAGGTGGCCGTGGTCTCGGAAGCTGTCGTCTCCGAG
GCGCTGCACCAGCTCTACAGCCCGCTGAGCTCGCCGCGCGTGCGTCGTCGTGCTGACTCGCTGCTGCAGCAGTTCCAGCGCTCTCCCGAGGCGGCGCAGA
CTGCGCTGGCCGTGCTGCAGGCGCCGGTTGTCGACACGGGCAACGCCGAGCACAATGCGCTGCTGCGAGCCAAGCGCGCGTTCGCTGCGTCGACGATCTA
CTTCACGGTGGCCTCGTACATTCGCAAGTACAAGATGGACGACCCGGTCAGCTGGACACCAGAAGATCGCGCGCAGCACGAGGTGCTGGTGAAGGACTTC
GGACAGATGGCACAGGACGTGTGGAACGTGCTGACGGGGCCGAACGGAACCCAGGAGGAATTGAATGTGCAGACTCACTTGGCGCTGACGATAGCTGTCA
TTCTGCTGCGTTTCCACGAGCCACAGGGCGACAGCACAGTGGTCGGGGCAGTGGAATGGCTAGTGCAAAACCAACAGCATCCGGTGAGCGACACCGTGAC
CGCAGCCTTGACCAATTTTGCTGTACTGCTGACGCTGAAGGTCATCCCGGAGGAAGTCGACAACAAGCGAGTCAAGTTTTCCAAGATGAAGCGGACTCAG
TGCGAGGACATGGTGCAGCATTGTGCCGCACACGTGGTTCGCACCGTGCTTCCATCGATCGCTACAGTTATTGATGCCAGCGAAGAACAGGTGCAGTTGC
GGGGGCTGTTGTTGCAAGCTTTCGCGAGCTGGGTGGAGCATGGGACAGTATCGCCGGCAGTTATTATCGAGTGCGGCCTGCTGGATCGAGCTTTCCGAGA
ATCGTTAGTTCCGGCGTCCTCGGTGTTTGCTCTACAGCTTGTACGCGAAGTCGTGCGTGCCTGTCGTCATGATGAGCATGTTCAGCTGATGGAACTAGTA
ATGCACAATTTCGTAATGCTAGGAAAGCACCTTCAGGAGCGTATGGCAGCTTCAGCGAAAAGTATGGATTTCTGTCTCGCTGACTGCGCAAGGGCAATAT
CGGAGTGCGGACAAGCGTTCATCGTGTATTTTGTGGATTACACGCTTGACATGCGACCTGGGTCCCTCGTTTACGAATTTTTGGACACAATTCTGTTCTT
CACGTCACTGAACAATCTGGACATCTCGAACGAGACGATGGAGTTTTGGATCATATTCCGCACATACATATCTGGAAAGCACGAGCAGCGCATGTTCGAA
TTTGAAACATTCATCTCACGATTGTTGGTCATCCTGATAGAGCGAACCCAGTATCCTGATGGGTTTGAAGCTTTTCCGGAAGCCGCCAAGGAGCGCTTCT
TCCTGTACCGAAGCGAAGTGCGCAATGTGTTCCGTGCTCTTGCTACTGTCACGATCGCTAGCGAGGACAAGTTCATTATAGATGCTATTCATGCGATCTT
TCAGCAGTACGAAGCCGCAGATTCCGGGGCCCCTATACCACCGGACGTACGTATGCGCTCACAATGCTTTCTTTACGGTTCCTAGGCAGCTAATTAATCT
CGTTGTTGTTGTGCGTGTCAATCAGTGGTGGCGGCGTACGGAAGTTTATGTACACGCTTTAAGCGCGCTATCAAAATCGATTCGTGAAGAAGACACATCC
CTCGTTCCAAGGTTGTTCGAATGTCTGTCGCGAAAAGAGCCCTCGCACCGCGCACTCTCGCGCACAGTCACCATCTTCCTTGGTGTAGCCGGCCATTGGT
TTGCTAGGCACCCGGAATACTTGGGGACGTACGCATTCAAAATTGTGTCAAACGGCTTCGAGCTCTCCCAGGACAATTCCGGTTTTCCATTCAGTCAGCA
TGGTCTTGAAGACCACGTCGGTGCTGTTGCACTTCGGAAATTGACGCTTCGCTGTGGGTCCCACTTCTTTAACCCGCTGTGGATGGACGCGTTGGTGAAT
CTGTACCGCTCGAATCGTGCTGCTATAGGCCGGTCGTCGGGACCATGCTTGACGGGAAATAGTGCGAAGCTAATTGTGGACTCTATTTGTCATGTCCTCA
CGACTGTGTCGTACAAGGAAGCGCTTCCTGTAGTGGAAGAACTTGGTACGATCATGTTCACCGATCTTGCATCGCGGTATAACCAGCTAAGTGCAGACGA
TGAAGGTTCCGTTGAGTTTCTGTGCGAAATGTTCAACCATCTTCTCGTGTTGGCAACACGAATTCCTCTCCAGATGGATCAAGAAGTAATACATCCTGTG
CTGTGTGTGCTGCAGAAGCAATGGGGGGTGTTGGAGACCATTTTACGGGTGTATGGTTGCTGCGAGGAGGTGATCGCACAATTCTGTGCGCTGCTGGTGG
GCGTTTTCGAATCATTGCGATCTCAAGCGCTAGAACTGGCATCCGCAATCATGCCAGCATTGCTGGAACAGTTCTCTCGGAGCCATGACGGTAGCTATTT
AGGCGTGATCAAAAGTATCATTGGGTGCGCTGGTGATGACGAGGCTACAGCAGTCAGCTTAACACGCGTGATGGTGATTGTCAGCGAGAGTTCAATGAGC
AAAATTGCGGCAGATGGGAGTGTCGATGAGCATCCCGGACTAACTGGCGCATTGTTTTCTCTGGTGGCTACCTGCGGGACTCACCACCCCTCAATCCTTG
TGCAGTCAAATCAGCTTGAGGGTGTTTTGGCGTTAACACTACATGCTTTCAAGTCCCAGAACCCCGAGGTCGGAGCCGCAACGCTCGACTTTCTGCTCGA
GTTGGGATCACTCTATGGGCAGATCCTGCGCACCCCGGAGGCATTGCTTCATGGCCCCGAGTTCGCGGGGAAGCTACTACTTCATCAACAAATTCAGACG
CTATTCTTTGAGAAGGACGTGCAGTACCACGTTCTCTTCGCGCTGTTTAATGCCGCTGCTGGAGGCATGTCGCCAAATCTGATGGAGAAGATCGCGGAGG
TCGTTCGGTCTTGCTGGGTGTACTTTGGACGGCAGCGAAGTGAAGAGCTGATCCACCGGCTTCTATCCGACAGCAACTTTTTGGGGTCGCAGGTCAGTGA
GCGCGCTCGAACAGAGTTCCTCAACTACATCTCCACACCGACGTGTGTGGAAAATTCGCGAAAGTTTAAGCGCGTACTAAACGCGTTTTGCGATCATTTC
AAGCGCAACCTTACAGGCAGTGCGAACGGTGAAGCAATGCCGTCGTAGGCAGCGCGTGTCAAAGCCAACGCGTACAATATGCATCGGGGTGGTAAAAGCA
AAGCAAGCAAGCGGTCAGATCTTTTAGGGAAACGATGCAAAAATTATCTCCACGCTTGGCCTGGTCAGGTAACGTTTCTACTGAAACGGGTTGCCAACGT
CCTTCCACGTCGTTGTGTTGTTTTCCGTGGTGGCAGTGATCAAATGTCCACTCGGAGGGCGAGCAGAGGGGAGCGCGTTAGACCACTCCAAAACCTTCTC
ACCAATCTCCTCCGCCTAAGCATTAAACGTTACCATTGGTGTTAGCTCAGACTGCAAAGCAAACACCACACAGGTACTATTACAGTTTACCTTGGTCCAG
GTCGAGAAGTCCGCGTCGGCCATGAACTTCCGATTCATCGGTGTATCAATTGTCAACGGAAGCACGCCCAGCACGGACGAATCTTCCGGGAGCTCAGACC
TAGTTAACGAGAGAGAAAAAATATAATCAGCTTTCCCAGAATTTCAAGATCATTGCATCATGCAGCAACGTCTTACACAGCACTGGCGATCAGATGATGA
GTGGCCGCCTTGCTCGCTCCGTACGACACCATGCCAGGCGTAGCCTTGAGAGCTGCAGCCGCCCCCGTCAGAACGAGCAGCCCACCGGGCACCAGCAAGT
GGCTGGCCAAGTACGTTGCTACAGAGAACACAAAGAGATGTTAGCAGCGGCACAAGCAGCAGCATTTCCAAACTGTCCACCCACCCAGGAAGGCCGACTC
CAAGTTCTTGGCGTGCATGTCTCCCAAGTTGACGAGCGAGTCCGCGTCGCGGATGCTGCCGCCGGCCCAGCCGCCAGCCGTGCACACGACCGTGTTCATC
TTGCCATACCTGCCCACCTCAAGTCAGTGTTGGGTGCAGTAGCATTGCATAATGCAATAGCCACGCAACGGACCTGCTCGAGATCTCTTGCAGCGTCTGC
TCCGCCTGCTTCAGCGAGTTGCTCGCAGGCAGAAGCACGTTGTTGTCGGCGTCCTCGTTGGCCGAGAAACCTACGGACGTGACGCCCCAGGACGCACGAG
CGAAATGGTTCACCACACCGCGGCCCAGCGCACCGGCACCACCGACGACAAGCAGCTTCTTGGACATCGCCTCCTTGGCAGATTGAACAATGCGGGGCCA
TAGGCGCATTTAACACGGCAGAAAAGATTGTAGTATCTTGTACTGACTTGCTTTCAGTAAGGGGGTGAAAACTTTCGCGGTTTGCGCTACACCGCGCGTC
CTATCTTTGAGTTTGTCTCATACTGTGCGGTGCACAGTGCAAAAGGAAAGCTGCGGTTGGAGCTTGAAAACATTTTAGCACTTCAATTTACGTTTATCAA
CGACGTCTGAATACGAGCTGCCTTCTTACCAGCAGCGAACATACACTAGCGACGTATATATAGTCTATGAGAATTTCTCCGAGTGGAAGTCGAAAATCGT
GCCGTTGGGTTCCGTGGACGAATACTTCTTGCACGTGTTGTCCAGGATCTCCTCGAGGACGTGAGGGCCGCAGTAGAACACACCGATTTCTTCGCCAGGG
TGGTTGGCCTTGGCCTCGGAGAAGACCTTGTCCCAGTCAGGGCGACCGAAGTGGGTCAGTTGCTTCGTGCTGAGACCGGACACGAAATCCTTGCCGGTCT
GCTCGTGCACGAACTCCTGGAACATCTTGAGCTGCGAGGTGTTCTCGCTGCCCTTCAACGTACTCAAGTACTGGTGCGTCTCGATCACGTTGTCGCGGTC
CATTTCGGCGATCTGGTTCATCGTTTCTTCAAACCAGCTCAACGATTCCTGACCACGGGTCACCCAGTGGAAGTACAGCTTCTGGATCTTGAACGAGCCC
GGATGGCGAACGTGGCTGCAGTTCGGGCATCGGTTGTCCTCCCAGAGGTGAACAACATCCTTCAGAATGGAAGCGAAGGGGGTAACACCGATACCGCCGC
CGACGCAGATCACAGTCTTGTAGCGATGATAATCTTGCGTCGGGGCACCAACAGGGCCATCGAGGTAGATGTCCGGATACAGCACCTTACGCTCATGGCA
ATCAGAAATTACCCGAGCCAACGCTTGCGTCCAGTCACCGCAGGTACGGATGTGAACGCTGATGTAGTTGTCACCAGGAGCCGATGAAATCGTGAACGGG
TGCCATTCATGCGAAGAGATGAGGGGGCAGTTGACGAACATGTACATGCCCGGGCGGTACACAAAACGACGGGGCTTCTCCATGAATAACGCGACAGTGC
CGTCCAACTCCATGGCCTCCATGATACGCACGGGTGCTGCGAACATCTTGGCGTAGCGGAATCGACGCTCGATCAAATAAATGAGAAATGGAGGTGTGAT
CCAGATGTAGGAAGAGCTGCGAGCAAGCCAGGAGCAGGCTCCGTGAAAGCACAACACTATGAGAAAGGGTCCGAAGAGCATGTGGGAGTACCAGAAGAGG
TTGAACTTGCCCTGACGAAACTTGGGGATCGCAGCGAGTGGAAACGAAATGCAAGTGATCACCAAAAGAATCGCGCCAGTCCACACCGGAAGCGACTGCA
ACATCGTGGTAAATGGAGGGCGTTCGCCGTTGACGAATGACGACACATGCCGAGTCACGAAGATTGAGTGCTTAATCTCCTCCGGGGTGGCAATCAAGTA
CAGGTAAATCTCGTTGAAAACGTGAGCAATCGTGTGAATAAGGCCTGCAATGAGCAGCACGCTGCCTGCAATCTTGTGAAATGCGATGCTGTCGTCGAAT
GGGATGTACCGCCAAAGGAAGCGGCTGCGCTTCATGACTTGCGTGATGGAGCGGCACATCGGCAACAGAACGAACACACAATTGACCATTGCAACTTGGG
CATTTGCGCGCGCGATACGAAGTCCCCAACCGATAGCGGGGTCCACGTCATAAGCGAACCACTTGACCCAGAAGGCAATGTTGTTAAGAATGGCGTAGAA
CAGAAGCCACCAGATGCGAAGCTTGTTGGCGCTATACCAAGCGCCGAATTTGCTCTTGGGGCGGATAGGCGCCGTGTACACAGGTTCGGACTTCTGCAGG
TTGTACGAGTCGGAAATGTAAGGAGCGAAGACCATCTTGAACTGCTCGAATGTCATGGACTCGTTCTTTACTTGAGCCTTGCGGAACATTAGATTCGCCA
CCGTCTTGAAATCTGTGCCGACCACGTCAAGGTGGGCGGCTGAGAAGTTTGACTCAAGAAGCTGGACGATCTGGTCTTCAATCACATATCCTGAGTTGTC
CGGGTCAAGCGTTTCAAAGATGAAACGCAGTTTCTCCTCGCCATTCACGTCGAGGTCCATAACGGCGTCGATCAGGATGGCGTTACCGTCGATGTCTCCA
TTGCCCGCGGCGTATCCGTCAAACTCGTCACCGTTGAGTTCGAAGGTCTGTGAGAAGGTCTCACGCTCGATGTATCCACCCTTGCTGGTGATGCTGCTCA
TAACATCGCGAAGTGCGTGCAGCTTCTCCATGGGGGTGTACGACGGGTCATTGACGTTCATGGCGTGCTCGTCCATGCTCATAGCGACGGTGTACTTCTG
CTCGAAGTTGCAGTCGCCCAGGACCGGGACCGACACGACGTCGGAGCCGGGCTGCGGGCCGTACCGGGACCCAGCGAAGGAGGACAGGTTTGACGCTCGC
GCTAGACTCTGGCGCACCATAGAGGATCCCAGCATGGCCTGGACGTTGGGTCGGCGGCGAGGGCCGCGACTGCCCTTGCAGTTGGAGCTCATCTTGGGTG
GGCCGCAGCCGATGATGTGTGTCGCTGTGGGGTCCATCTTGAGGAACGGGCTGGTGTCCATGAAGCTGGACTTGGTGGTGCTCCGGAACGGGGACACCAT
GTTGGGGTGGCTGCCCATGGACGGGTGCCCGTgcgacggtggcagtggcggcggcggcggcggGGTCTGCGCGCGCTTCTCCTTCGTGCTGCCCCACATG
CTATTCGATCTGCTGTTAGTTCTGCTGTTGGCCCTGCTACACGACCTGCCGGATGACTTGCTGGTCGACTTGCTGGTCGAGTTGTGCTGGAACTGGCGGG
CGTTGGGGGAGGGCGAGGAGATGTCGACGAACGGCTGCATGTTCTGGCCGGGCGTGATCTTCAGCTCGTCCGCTAGCTGGCGCGCGGGAGCGCCGCTCCC
CATACGGATGCGGTTCTGGCGGTCGCGGTCCATTTGCGTCCGCCGAGGCGCTTCGTGTCCTTGCAAAGGCGGCGAAGAATGCAAAGTGTCGTGCCGTGCA
GCGCAGCAGTCACGACGATGCGGCCGGTAGAAGTCCTCAACCGACTGGCGCGGACGCGTAGCACGCTAGGTTTAGAAACACGCGGCACCTGTGGACCGGG
AAAACAGGCAGGTGGCACTGCCTACGGCCTTGCAATCGCAAAATGGCGAAGTGGCCGCCGTCGCGGCGCATCAAGGCATCGTTCCTGCTGGCGCTTCCAC
CTGATcggcgccgcgccccggccgtgcgcgcggTGACTCGTCAGTGTAAAGTTCAGCCCACCGAACTGGGACTTCTTGTTTCTTGTATGTCAGGGCCGTT
TCTGCGCGCGCTTTGGTCCGACTCTTGCAGCGAAGCCAAGGATACTTTTCGGATGGTGCCGCCACCAGCTGCCAGCTGGCATGGCGGCACAAGTGCGCCT
CACGTTCCCGCTGA